1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Taya2010 [7]
3 years ago
9

Without the presence of sea otters, sea urchins would otherwise overgraze kelp beds, dramatically changing the marine community

of which the urchins and otters are a part. For this reason, sea otters are considered _____. a parasite a keystone species a predator an indicator speciesWithout the presence of sea otters, sea urchins would otherwise overgraze kelp beds, dramatically changing the marine community of which the urchins and otters are a part. For this reason, sea otters are considered _____.
Biology
2 answers:
VARVARA [1.3K]3 years ago
7 0
A keystone species would be the correct answer
densk [106]3 years ago
6 0
I think it is keystone.  If they were not there the population of urchins would go up and the kelp would go down.
You might be interested in
Are my answers correct for Q1??
sertanlavr [38]

You're correct.

Just make the last one OO

7 0
2 years ago
Why honey is beneficial for even diabetic patients​
kumpel [21]

Answer:

One benefit of eating honey is that it could increase your insulin level and help control your blood sugar. Replacing sugar with honey can also be beneficial, considering how honey is a source of antioxidants and has anti-inflammatory properties.

Explanation:

6 0
3 years ago
Which statement is true for photosynthesis? Producers use it. Consumers use it. Scavengers use it. Decomposers use it.
ololo11 [35]

Answer:

A. producers use it

Explanation:

6 0
3 years ago
Intermolecular attraction describes how the particles that make up matter are attracted to each other. The graph below compares
krok68 [10]

Anything that  says further apart is incorrect. So B is incorrect.

A is correct as near as I can tell.

C is not correct. The particles. I think C is the right answer supplied with the wrong reason. Regretfully, you can't choose it.

Same answer as C for D. Right answer wrong reason.

Answer A.

6 0
3 years ago
Read 2 more answers
The caplike structure on a sperm cell that helps aid egg penetration is called the
madreJ [45]
I think it's called the Acrosome
7 0
3 years ago
Other questions:
  • WILL MARK BRAINLIEST!
    8·2 answers
  • Which of the following is a way a group behavior can help a human community survive?
    14·2 answers
  • The study of proteomes allows scientists to compare
    10·1 answer
  • PLEASE HELP :,,,,,,,,,,,,,|
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How do environmental factors influence genetic traits?
    6·2 answers
  • Which of the following epithelial tissue locations is NOT correctly matched to its function?
    8·1 answer
  • 2. _______ are deep valleys with cliffs or steep slopes along their sides. Canyons Volcanoes Ranges Alluvial fans
    13·2 answers
  • Which area of rivers and streams will most likely contain the most sediment?
    8·1 answer
  • Which structure does the immune system target in type 1 diabetes?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!