1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makvit [3.9K]
3 years ago
8

Determining the likelihood of two samples with the same characteristics being from two different sources is calculating

Biology
1 answer:
Artyom0805 [142]3 years ago
6 0

<u>Answer:</u>   Comparison

<em>Comparison is the determining the likelihood of two samples with the same characteristic being from two different sources.</em>

<u>Explanation:</u>

While comparison is made there is always a certain similar character taken which are common in nature. After <em>the two topics are placed in front then decision can be made easily on various basis. </em>

Comparison does gives the <em>definition for the good and the bad, pretty and ugly.</em> It can also be sued in a negative way to dominate someone.

You might be interested in
Which of the following is the correct meaning of transpiration?
Step2247 [10]
I think it's the evaporation of water through the stomata :)
3 0
3 years ago
Read 2 more answers
I NEED HEELLLLPPP PLEASEEE​
Musya8 [376]

Answer:

lipid, fatty acid, cell membrane

protein, amino acid, enzyme

carbohydrate, sugar, starch

nucleus acid, nucleotide, DNA

4 0
3 years ago
How is HIV is a modern-day driving force for human evolution?
juin [17]

Answer:

Testing positive for HIV means a high chance of death and a good chance of lower reproduction rates. But some people are immune to HIV, which makes them more evolutionarily fit, likely to live longer, likely to reproduce more, which would increase the frequency of the immune allele in the population. Over time, this increase in frequency of the gene that causes immunity could spread across the human race and cause it to evolve.

4 0
3 years ago
What experiment did Charles Darwin conduct
ad-work [718]
The evolution of emotion that’s what Charles Darwin conduct
7 0
3 years ago
True or False? Every time you speed up, you are experiencing acceleration.
Alecsey [184]
True...................................
7 0
4 years ago
Other questions:
  • In the 1950s, Christian Anfinsen demonstrated the renaturation of the protein ribonuclease (RNase) in vitro. After reduction and
    9·1 answer
  • Which additional observation will Alyssa most likely make?
    12·2 answers
  • Which of the following is not one of the three ingredients needed to form a cloud? dust or solid matter of some sort water molec
    10·1 answer
  • Explain why large, multicellular organisms must have trillions of microscopic cells rather than thousands of larger cells.
    14·1 answer
  • DNA seen during interphase of mitosis is in a diffused state called _____?
    10·2 answers
  • How many autosomes does a human female have? <br> What are her sex chromosomes?
    13·1 answer
  • Which of the following statements is true of meiosis? (4 points)
    6·1 answer
  • What are some future treatments that are on the horizon?it about Cancer
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • I need this question nowwwwww
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!