Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
<h2>Answer:</h2>
The one condition that must be met for a population to be in genetic equilibrium:
A Large Breeding Population.
<h3>Explanation:</h3>
- A large breeding population helps to ensure that chance alone does not disrupt genetic equilibrium.
- In a small population, only a few copies of a certain allele may exist.
- If for some chance reason the organisms with that allele do not reproduce successfully, the allelic frequency will change.
Answer:
The correct answer will be option-A
Explanation:
The centrifugation of the blood shows that 45% of the blood is composed of the cellular content and 55% blood plasma or liquid.
Erythrocytes or red blood cell constitute for about 41% of the total blood cells which transports the oxygen by binding it to the haemoglobin. The presence of haemoglobin is the reason the cell appears red which cause the color of the blood to appear red.
The remainder of the cell is white blood cells or leukocytes which play important role in providing the defence mechanism against the pathogen.
Thus, option-A is the correct answer.
<span>Covered with tough dry scales.
Ectothermic(an animal that's dependent on body heat)
Breathe with lungs throughout there lives
Three-Chambered heart with a ventricle that is partially divided
Produce amniotic eggs covered with a leathery shell, most oviparous, some oviparous.</span>
