1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
4vir4ik [10]
3 years ago
12

The length of time required for half of the radioactive atoms in a sample to decay is its

Biology
2 answers:
sergiy2304 [10]3 years ago
7 0
The correct answer is half-life. The half life defines the minimum amount of time it will take for a particle to reach the point in the decay process in which it has experienced half the time of it's expectancy. 
anastassius [24]3 years ago
7 0
A half life is the time it takes for half of a certain type of atoms to decay :)
You might be interested in
Animals have tactile sensors located at different paths of their bodies. For example, cats have sensitivity in their __.
baherus [9]
I think the answer is vibrssae or whiskers.
7 0
3 years ago
Don't copy and paste from other question answers plss. I'm giving 40 points
Artist 52 [7]

Answer:

Our bodies have the ability to detect how things smell, taste, appear, and feel. What organs does your body employ to gather the data mentioned in the previous question? Our eyes, nose, mouth, ears, and skin are all used by our bodies.

6 0
3 years ago
Conduct a dihybrid cross of pea plants with the following combination of traits: Parent 1—Tall plant with white flowers (pure br
Angelina_Jolie [31]

Answer:

i) Genotype of Parent 1= TTpp

Genotype of  Parent 2= ttPP

ii) The genotypes of their gametes

Parent 1= Tp

Parent 2= tP

iii) F1 generation = All TtPp (tall and purple flower)

iv) F2 phenotype ratio= 9 tall, purple: 3 tall, white: 3 dwarf, purple : 1 dwarf, white.

F2 Genotype ratio= 1:2:1:2:4:2:1:2:1

Explanation:

Let's assume that allele "T" gives tall plants while allele "t" imparts dwarfism. Likewise, the dominant allele "P" is responsible for purple flowers while recessive allele "p" gives white flowers.

i) Genotype of Parent 1—Tall plant with white flowers (pure breeding)= TTpp

Genotype of  Parent 2—Dwarf plant with purple flowers (pure breeding)= ttPP

ii) The genotypes of their gametes

Parent 1= Tp

Parent 2= tP

iii) F1 generation = All TtPp (tall and purple flower)

iv) Each of the F1 plant with TtPp genotype will form four types of gametes= TP, Tp, tP and tP

A cross between TtPp x TtPp gives F2 progeny in following ratio=

F2 generation phenotype ratio= 9 tall, purple: 3 tall, white: 3 dwarf, purple : 1 dwarf, white.

Genotype ratio= 1:2:1:2:4:2:1:2:1

5 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Theodor W. Engelmann illuminated a filament of algae with light that passed through a prism, thus exposing different segments of
WARRIOR [948]

Answer:

The correct answer is C and Engelmann conducted this experiment to prove relationship between algae and the rate of photosynthesis.

Explanation: First we must talk about 3 facts:

1) Prism scatters the white light into different wavelengths.

2) Photosynthesis, 6 carbon dioxide and 6 water molecules are consumed and 6 oxygen and 1 sugar molecule is synthesized using light energy.

6CO2 + 6H2O → C6H12O6 + 6O2

3) Aerobic bacteria breaks down sugar while using oxygen and produces water and carbon dioxide in simplified terms.

So with this experimental setup a researcher can understand the rate of the photosynthesis by increased accumulation of aerobic bacteria near algae  in certain wavelengths since they uses oxygen and tend to move close to the oxygen source (<u>see figure</u>). In this experiment there are no ways to measure heat (B), there is no known relation between wavelength of light and aerobic respiration since it can happen even in the dark (A) and finally there are no ways to measure carbon dioxide (D).

5 0
3 years ago
Other questions:
  • Which of the following statements about Ngb-H64Q is true?
    6·1 answer
  • Eplain I terms of osmosis why a raisin placed in a cup of water overnight will puff up with water
    5·1 answer
  • With an occluded front, _____.
    15·2 answers
  • Which statement best describes a characteristic of a scientific theory?
    8·2 answers
  • What property of dna makes it possible for a probe to find a single-stranded dna target gene?
    13·2 answers
  • Como se organizan las celulas para formar diversas estructuras en los seres vivos
    9·1 answer
  • Which DNA fingerprinting technique examines the length variation of DNA repeat sequences in human DNA? variable tandem repeats a
    9·2 answers
  • Enumerate the function of blood?<br>​
    13·1 answer
  • Only a small amount of energy consumed by an organism is available to flow to the next organism in a food web. Which of the foll
    5·2 answers
  • Genetic drift will have a progressively larger impact on allele frequencies in a population as ____.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!