A high level of gene flow into a population increases genetic diversity in a population. A high level of gene flow out of a population decreases genetic diversity in a population. Genetic drift is the change in allele frequencies due to "sampling error" factors. Typically, genetic drift has the biggest impact on small populations.
Gene flow (or gene migration) is a mechanism of evolution (change the allele frequencies) which transfers genetic variation among populations due to migration. High level of gene flow decreases the genetic differentiation between the two populations.
Genetic drift is a mechanism of evolution that acts by chance (“sampling error”) often when a population is reduced in size by a natural disaster (bottleneck effect) or when a small group leaves the main population and forms a colony (founder effect).
Is this just a random question or is there any information given to us about his parents? if not, C would be your answer
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
See the answer below
Explanation:
<em>The advice I would give to Zara would be that she should keep Bozo in a separate tank with common salt water away from the goldfish. Bozo is a salt water fish while the goldfish can only survive in freshwater.</em>
If Bozo is kept in a saltless water/freshwater tank with the goldfish, the water would be hypotonic to Bozo. Consequently, water will osmotically diffuse into the cells of Bozo, the cells would become turgid and lyse, and this would lead to the death of the fish.
If the goldfish is kept in the same salt water tank with Bozo, the salt water would be hypertonic to the goldfish. Consequently, water will osmotically diffuse out of the cells of the goldfish into the surrounding salt water, the cells of the goldfish would become flaccid, and this would lead to the death of the fish.
Answer:
The correct answer is : oxygen
Explanation:
- Oxygen is carried in the blood by two means:
- About 2% of the oxygen is carried in the dissolved form in blood plasma and in the water present in the red blood cells (RBCs).
- Rest 98% of the oxygen is carried in bound form with the haemoglobin as oxy-haemoglobin inside the RBCs.
- RBCs lack nucleus. This place is occupied by hemoglobin molecules that binds to oxygen and form oxy-hemoglobin.
- This increases the capacity of each RBC so that it can carry more oxygen to all the parts in the body.