1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artyom0805 [142]
2 years ago
11

Which gland produces T3 and T4?

Biology
1 answer:
Leokris [45]2 years ago
4 0

Answer:

<em>1. The gland that produces T3 and T4 is the </em><em>thyroid</em><em> (first option). </em>

<em>2. True. The </em><em>adrenal gland</em><em> produces and allows the secretion of the hormone involved in the fight and flight response. </em>

<em>3.The symptom that is not correctly matched with the organ system is joint pain, which is related to the joint system, not the skeletal system.</em>

<em>4. False. </em><em>Negative feedback loop</em><em> inhibits the production and release of hormones.The symptom that is not correctly matched with the organ system is Joint pain - skeletal system</em>

Explanation:

1. Thyroid gland is a small organ of no more than 30 grams found in the neck, in front of the trachea. This gland produces thyroglobulin, which when joined with iodine can synthesize triiodoythyronine (T3) or thyroxine (T4).

The main function of the thyroid gland is the regulation of organic metabolism, while it can also mediate the body's response to other hormones.

2. Adrenal gland is located in the upper pole of each kidney and is responsible for the secretion of several substances that help with the body's activity.

In the gland's marrow, a substance called adenaline is produced, with properties such as hormone and neurotransmitter, one of the main substances produced to deal with stress and the adaptation response called fight and flight.

The adrenaline produced in the adrenal medulla can strengthen muscles, increase heart rate and blood pressure, and increase the body's resistance to the presence of stressors or threats to physical integrity.

3. Joint pain is related to inflammation of the joint soft tissues, which belong to the joint system. Unlike joint pain, bone pain occurs as a result of injury to the periosteum -the thin membrane that covers the bones- which is related to the skeletal system.

Painful inflammation of the joints is called arthritis, and is one of the main causes of disability to perform normal body movements.

4. <u>Feedback is a control mechanism of the endocrine system</u>. Negative feedback loop occurs in response to a stimulus, resulting in the inhibition of mechanisms that promote the synthesis and release of substances.

An example of negative feedback is the sufficient production of thyroid hormones, which sends a signal to the hypothalamus, which in turn inhibits the production of TSH - thyroid stimulating hormone - at the level of the pituitary gland. If the pituitary does not release TSH, production of thyroid hormones ceases.

Learn more:

Thyroid feedback loop brainly.com/question/4967372

You might be interested in
Which lipid acts as a chemical messenger? adipose tissue cholesterol testosterone beeswax
liq [111]
The answer is testosterone.

Testosterone is an androgen sex hormone. Like all other hormones, it serves as a chemical messenger. It will bind to its receptor in the cell and that way performs its function. Among all choices, only testosterone is a hormone a chemical messenger. Adipose tissue is tissue, cholesterol is lipid and a structural component of cell walls and can be a precursor molecule for some biochemical pathways. Beeswax is a natural bees' product.
4 0
3 years ago
Read 2 more answers
Please help, I have no clue
Masteriza [31]

Answer:

freshwater fish

Explanation:

7 0
2 years ago
Read 2 more answers
How do intrusive rocks form?
IgorLugansk [536]

!!•••••••☆☆ Hey mate ☆☆•••••••!!

Intrusive igneous rocks cool from magma slowly because they are buried beneath the surface, so they have large crystals.

Extrusive igneous rocks cool from lava rapidly because they form at the surface, so they have small crystals.

☆☆☆☆• Hope Help u •☆☆☆☆

3 0
2 years ago
Read 2 more answers
**WILL BE GIVEN MEDAL**
Sauron [17]
A, i think, hope this helps:)
4 0
3 years ago
Read 2 more answers
The semifluid material that fills most of the cell outside the nucleus is called?​
Natali5045456 [20]

Answer: cytoplasm

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Which best describes John Greenleaf Whittier's purpose in "The Fish I Didn't Catch"?
    10·1 answer
  • The most plausible evidence that the development of cancer is a multistep process can be:
    8·2 answers
  • Average human males are most likely to be attracted to women with a waist to hip ratio of 0.72. women with this waist to hip rat
    5·1 answer
  • Science helps people learn about the way the world works. What is the goal of technology?
    13·2 answers
  • What comes first translation or transcription
    10·1 answer
  • After plants absorb energy from the sun the energy gets converted into ____energy for the plant to carry out life activities .
    13·1 answer
  • A seed was discovered and when planted grew to be a large flowering plant.
    6·1 answer
  • As recently as two decades ago, scientists believed we were born with all the neurons we would ever have. But the discovery of _
    5·1 answer
  • Which stable element is used to determine the age of volcano rock<br>​
    8·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!