1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zolol [24]
4 years ago
7

Location Two: Select three events that you predict will be observed. If I explore two continental plates at a divergent boundary

, then I will observe: __________________________
● earthquakes
● faults
● ocean formation
● mountains
● volcanoes
● island chains
● seafloor spreading
Biology
2 answers:
serious [3.7K]4 years ago
4 0

Answer:

ocean formation

seafloor spreading

volcanoes

Explanation:

Because I have done this, sorry if this is not correct.

makvit [3.9K]4 years ago
3 0
I think it’s
Ocean formation
Sea floor spreading
Volcanoes
Sorry if I’m wrong
You might be interested in
What energy roles do organisms play in an ecosystem?
Alexxx [7]
<span>The organisms in an ecosystem fills the energy role of producer, consumer, or decomposer.</span>
6 0
3 years ago
5. The positive side of the battery will have a ______
Romashka [77]

Answer:

Higher?

Explanation:

4 0
3 years ago
Read 2 more answers
The sequences at the ends of linear chromosomes are called _______________. A protein that uses ATP hydrolysis to separate the t
Nutka1998 [239]

Answer: Telomeres, Helicases, Okazaki, DNA polymerase, Topoisomerase

Explanation:

1. Telomeres these are set of repetitive nucleotide sequence found at the end of a linear chromosomes they help preventing the DNA chromosome frrom sticking to other DNA chromosomes.

2. Helicases are proteins that uses energy (ATP) to unwind DNA strands during replication.

3. Okazaki fragments the small DNA nucleotide sequence synthesized separately on the lagging strand.

4. DNA polymerase are enzymes that catalyzes the addition of deoxyribonucleotides to DNA during replication.

5. Topoisomerase are enzymes that prevent single stranded DNA from supercoil, rumple and winding back during replication.

8 0
3 years ago
1. What interactions affect protons in an atomic nucleus? More than one answer may be correct.
irga5000 [103]
A=
In the nature there are four fundamental forces, namely nuclear force, electromagnetic force, weak force, and gravitational force. These forces are arranged with respect to their strengths in descending order.
The nuclear forces are of greater strengths.
These bind up the protons and the neutrons in an atom together. The nuclear forces are strong enough to combine the quarks that form the nucleons.

B= The weak forces of the interaction are the forces that are short ranged and cause the instability of the nucleus. These are 1/10^5 times of the nuclear forces.

C= The electromagnetic forces are the forces that which combine the atoms and the molecules that intend form the ordinary matter. The electromagnetic forces are 1/10^5times of the nuclear forces.

D= The gravitational forces are 1/10^5 times of the nuclear force.


If you have more questions let me know
5 0
2 years ago
PLEASE ANSWER ASAP! WILL MARK BEST ANSWER AS BRAINLIEST!!!
PilotLPTM [1.2K]

Answer:

Its the second one

Explanation:

Only ten percent gets transformed to the next thing on the pyramid so it's the second one.

5 0
3 years ago
Other questions:
  • In an element's square on the periodic table the number with the greatest numerical value represents the
    13·2 answers
  • Which condition results when cells receive three copies of chromosome 21?
    7·2 answers
  • Which statement best explains how form and function are related?
    11·1 answer
  • Homeostasis refers to
    6·1 answer
  • Which would least likely be seen on an information pamphlet for red tide ?
    7·1 answer
  • Rafael models a longitudinal wave using a coiled-spring toy. If he wants to model a longitudinal wave that carries more
    8·1 answer
  • The area of a neuron that contains the nucleus and other organelles is called the ____________.
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • When Nepal clear-cut its mountainous forests, it created environmental disasters in other countries. Which of the following is n
    6·1 answer
  • What does it mean to say something “radiates”?<br><br><br>Explain your answer.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!