1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rjkz [21]
3 years ago
7

Where does anerobic phase in cellular respiration occur

Biology
1 answer:
Karo-lina-s [1.5K]3 years ago
8 0

Answer:

Anaerobic respiration

Explanation:

You might be interested in
Identify structures found in fungi
andrew11 [14]

Answer:

Its the third one

Explanation:

7 0
3 years ago
Jordon had surgery to repair her outer ear. What is the medical term for this surgery?
Mars2501 [29]
Ossiculoplasty is the term to repair the outer ear.
7 0
3 years ago
Read 2 more answers
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Soils are part of our natural capital and all terrestrial life depends on it. most mature soils have about how many soil horizon
lisabon 2012 [21]
I believe that most mature soils have three soil horizons. That is Horizon A, Horizon B, and Horizon C. Horizon A, also called the top soil contains a mixture of mineral matter and organic matter, as well as many insects, fungi, and microorganisms. Horizon B, also called the sub soil, contains fine clay particles washed out of horizon A. Horizon C contains partially weathered parent material.
4 0
3 years ago
An investigator collects a blood sample but does not know if it is from a
Rama09 [41]

Answer:

The correct answer would be A, confirmatory test.

Explanation:

A confirmatory test will let you know whether or not the blood obtained is from a human or an animal. I hope this helps you:)

8 0
3 years ago
Read 2 more answers
Other questions:
  • Find the volume of an object that is 30 cm long, 80 cm wide, and 120 cm tall.
    11·1 answer
  • What is the power house of the cell? (FREE 99 PTS)
    6·2 answers
  • Archaea are thought to have diverged from some ancient group of _______ bacteria.
    6·2 answers
  • how do you think the change in chlorophyll levels is a response to changes in the lenght of day from summer to fall
    7·1 answer
  • A hydrogen atom that los s its electron and becomes positively charged is called a(n)
    15·1 answer
  • Can you guys help me please!!
    6·2 answers
  • Explain how consumers are divided into groups​
    15·1 answer
  • What are gametes?
    9·2 answers
  • Honey bee is a social insect .Why?
    5·1 answer
  • Summary about DNA , Genes , Traits , Chromosomes. (Explain & let me know about all 4 words. Summarize all these words.) Writ
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!