3 years ago

Which piece of equipment would you most likely use to study a unicellular organism? A) ruler

2 answers:

8 0

Microscope is the answer

6 0

Microscope. You’d need the ability to magnify it to be able to see it

You might be interested in

nadya68 [22]

Answer:

Proton has a positive charge.
Neutron has a neutral or no charge.
Electron has a negative charge

Explanation:

Trust me

3 0

2 years ago

Goryan [66]

This process occurs from the nucleus of the cell to the cytoplasmic environment of the cell structure.

5 0

3 years ago

ValentinkaMS [17]

Line graph is the method he will need to use.

8 0

2 years ago

Serga [27]

A contour interval is the lines on a topographic map that state the height (from sea level) of the hill, valley, mountain or the ground level.

6 0

3 years ago

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago