1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anvisha [2.4K]
3 years ago
5

WhIch spheres are zones of Earth's atmosphere?​

Biology
1 answer:
Misha Larkins [42]3 years ago
8 0

Answer:

Layers of the atmosphere. The atmosphere is comprised of layers based on temperature. These layers are the troposphere, stratosphere, mesosphere and thermosphere. A further region at about 500 km above the Earth's surface is called the exosphere.

Explanation:

You might be interested in
Match the description to the type of energy.
attashe74 [19]

Answer:

1)diaphragm vibrations- sound waves

2) Changing magnetic fields- Electrical energy

3)sound waves- Mechanical energy

Explanation:

A changing magnetic field induces an electromotive force and then an electric field which contains electrical energy

Sound energy is a form of energy that can be heard by humans. Sound is an example of a mechanical wave because it consists of physically oscillatory elastic compression.

A diaphragm is a thin surfaced cone used to produce sound. It is caused to vibrate using electromagnetic energy.

3 0
3 years ago
Please help me answer these questions!
Harrizon [31]
#6 is A. They are all composed of one or more cells.
7 0
3 years ago
Read 2 more answers
A pair of rabbits produce several offspring. Those offspring later produce their own offspring, which in turn produce their own
kolezko [41]

Answer:yin’s she’s

Explanation:

Bjurhe

5 0
3 years ago
Please help me asap i will give brainlest
ZanzabumX [31]

Answer:

number 1 its 25 number 2 its 10000

Explanation:

8 0
3 years ago
What observation could lead to the conclusion that a object is nonliving
katrin [286]


1. Not breathing

2. Not giving off heat

Hope this helps


8 0
3 years ago
Read 2 more answers
Other questions:
  • A(n) _____ is a group of cells, with similar functions, that work together. organ tissue unicellular system
    7·2 answers
  • Which of the following conclusions can be drawn from the case study of Phineas Gage’s accident, which led to brain injury?
    15·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Heterotrophic organisms used the process of fermentation to nourish. What is fermentation?
    9·2 answers
  • Polyploidy is involved in which type examples?
    5·1 answer
  • Which statement best explains how two identical copies of a very large molecule can be made during DNA replication?
    15·2 answers
  • The haploid stage in a plant life cycle is called the____________.
    6·1 answer
  • What does competition mean and how might you see competition in an ecosystem?
    13·1 answer
  • Plz help i will. <br>I have no idea. ​
    11·1 answer
  • No spam if u spam i will report u
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!