This discovery demonstrated one of the strengths of Models may be used to expect or provide an explanation for occasions is the statements as it should be describe models in technological know-how.
<h3>What is the importance of models?</h3>
Models have usually been vital in technological know-how and stay used to check hypotheses and expect information. Often they may be now no longer correct due to the fact the scientists of the models.
- Scientific modeling is likewise referred to as a systematic activity. The goal of the modeling can apprehend easier, define, quantify, visualize.
- Normally Science is a topic which can not genuinely provide an explanation for furthermore it's miles to be interpreted.
- There are one-of-a-kind sorts of gift a number of them are mathematical , graphical fashions, operational , etc.
- Scientific are growing withinside the fields of technological know-how schooling and Philosophy of schooling.
Read more about the models:
brainly.com/question/24414910
#SPJ1
Answer:
The cell wall surrounds the plasma membrane of plant cells and provides tensile strength and protection against mechanical and osmotic stress. ... Plant cell walls are primarily made of cellulose, which is the most abundant macromolecule on Earth. Cellulose fibers are long, linear polymers of hundreds of glucose molecules.
Explanation: brainliest
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
I’m pretty sure it’s false
The answers would be:
Genotype Phenotype
Tt Tall stemmed
tt Short stemmed
Genotypic ratio : 2:2 or 1:1
Phenotypic ratio: 2:2 or 1:1
<u />
<u>You can read on to see how this was done:</u>
Tall stems (T) are dominant to short stems (t).
First figure out the genotypes of the parents. We have a short-stemmed plant and a heterozygous long-stemmed plant cross.
For short stem to occur, you need 2 pairs of short alleles. So the first parent would have a genotype of tt.
Heterozygous long-stemmed means that the parent has one of each allele. So the genotype of the second parent would be, Tt.
Now we can make our Punnett Square.
tt x Tt
<u> t t </u>
<u>T | Tt | Tt</u>
<u>t | tt | tt</u>
Let's list down the genotypes and phenotypic results.
Genotype no. Phenotype
Tt 2 Tall stemmed
tt 2 Short stemmed
So from that we can answer the other questions:
Genotypic ratio : 2:2 or 1:1
Phenotypic ratio: 2:2 or 1:1
