1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastova [34]
3 years ago
8

There are several mechanisms through which reproductive isolation occurs. Which situation is an example of behavioral isolation?

Biology
1 answer:
Ipatiy [6.2K]3 years ago
3 0
I think it’s a but not sure
You might be interested in
Movement of the chromosomes during anaphase would be most affected by a drug that prevents which of the following events in mito
xxMikexx [17]

The correct answer is: C) shortening of microtubules

Chromosome movement is possible thanks to changes in microtubule length. Several types of microtubules are involved. First, during the anaphase kinetochore microtubules shorten and consequently the chromosomes move toward the spindle poles. Then the astral microtubules that are anchored to the cell membrane pull the poles further apart. At the end of anaphase, the interpolar microtubules slide past each other and that additionaly separate the chromosomes.

3 0
3 years ago
When a cell needs to release energy what happens to the atp molecule ?
Harlamova29_29 [7]

Answer:

When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

Explanation:

5 0
3 years ago
2 The chemical symbol for the element calcium is Ca. What would be the symbol representing calcium atoms that have lost two elec
Ivenika [448]
Ca+2 , the plus 2 indicates the loss of 2 electrons
3 0
3 years ago
Do stem cells and specialized cells have the same DNA?
Sindrei [870]
There is also evidence that they may not have the same capacity to multiply as embryonic stem cells do. Hope this helps :)
3 0
4 years ago
Read 2 more answers
What causes sediment to change into hard rock?
KiRa [710]
<span>The sediment is compacted by heat and pressure, causing it to because  hard rock!</span>
8 0
3 years ago
Other questions:
  • Ben wants to convert some leftover food and organic matter in his garden into an eco-friendly form. Which method can he use?
    9·1 answer
  • A process which is essential to the whole species but not to an individual
    10·1 answer
  • 21. When did the Precambrian era end?
    7·2 answers
  • What happens to a DP after ATP hydrolysis
    6·1 answer
  • A pregnant woman found a large variety of microbes that can be vertically transmitted. She is making a list for her doctor to as
    15·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What is represented in the diagram?
    6·2 answers
  • Can someone help me with this please.​
    7·1 answer
  • PLS HELP ASAPBacteria, viruses, protists, parasites, and fungi can all cause disease and can be referred to as ______.
    5·1 answer
  • A virus can cause cancer
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!