All categories

3 years ago

1. Explain the difference between casual and scientific meanings?

1 answer:

8 0

1. casual meanings are more generic and informal (hence the word "casual") while scientific meanings are more specific and formal.

2. No, because a theory and law are 2 different things. A theory explains WHY and a law explains WHAT.

You might be interested in

Which discovery did Gregor Mendel make?

lana66690 [7]

"Traits are inherited independently of each other" is the one discovery among the following choices given in the question that <span>Gregor Mendel did make. The correct option among all the options that are given in the question is the first option. I hope that this is the answer that has come to your desired help.</span>

8 0

4 years ago

Read 2 more answers

quzilet Which of the following occurs when DNA is replicated? Group of answer choices One strand of the parent DNA is preserved;

Bad White [126]

Answer:

The two strands of the parent DNA are separated, and two daughter DNA strands are formed.

Explanation:

DNA replication is a complex process which replicates or produces new DNA molecule from the parent DNA molecule mediated by enzymes and ATP.

The mechanism of DNA replication is known as the semi-conservative mode in which one new strand of DNA is synthesized complementary to the one strand of DNA. To form a new DNA molecule both the strand of the DNA gets separated and then a new daughter strand is formed complementary to each parent strand.

Thus, the selected option is correct.

4 0

3 years ago

Which of the following changes to the crust can happen from the movement of Earth's plates? (multiple choice) A.glaciers carve h

MrRa [10]

E volcanoes are formed

7 0

3 years ago

During an investigation, Steven filled two cups with the same amount of water and placed them in a 20 degrees Celsius room for 3

lisov135 [29]

Answer:

the question is not complete

6 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago