1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
5

How does deposition change Earth's surface?

Biology
1 answer:
astraxan [27]3 years ago
7 0
Well, while it's carrying sediments some drop and over time they pile up and up and eventually making a new landform.
You might be interested in
Predict what would happen to muscles if a pesticide that inhibits acetylcholinesterase was present at the motor end plate.
Anarel [89]
If a pesticide that inhibits acetylcholinesterase is present in a muscle, THE MUSCLE WILL BE CONTRACTING REPEATEDLY. 
The enzyme, acetylcholinesterase is the one responsible for the termination of muscle contraction, when this enzyme is deactivated, the muscle contraction will not be turned off and the concerned muscle will contracts repeatedly.
6 0
3 years ago
Which of Thomas hunt Morgan‘s hypothesis was valid
Alexandra [31]

Answer:

White eyes are lethal in male Drosophila was the hypothesis of Thomas hunt which was valid. Hence the answer is option B.

Explanation:

Thomas hunt Morgan was a famous American biologist. He was more famous because of his experiment on drosophila which contributed most of things about the lifestyle and health science in much of the findings about those insects.

He was also awarded by the Nobel prize for his works which was related to medicine in 1933.  He has also contributed many knowledge about the chromosome and heredity. he is finding is very helpful nowadays for the scientist and other biologist.

7 0
3 years ago
Read 2 more answers
Which of the following is NOT one of the functions of skeletal muscle? Which of the following is NOT one of the functions of ske
Rasek [7]

Answer:

regulation of the diameter of blood vessels and control of blood pressure

Explanation:

Skeletal muscles are the multinucleated muscles with striations and are attached to the bones (skeleton). The main function of skeletal muscles is to generate the voluntary movement of the body or body parts. The skeletal muscles of face, rectum, and urinary bladder generate their voluntary movement as per the will of the organism. On the other hand, blood vessels are lined with smooth muscles with spindle-shaped cells.

For example, the muscles present in the subcutaneous layer of the skin of the face are responsible for various facial expressions. Contraction of these facial muscles brings about the movement of skin of the face to generate a wide variety of emotions. Smooth muscles of blood vessels are involuntary in nature.

Vasodilation and vasoconstriction as brought about by smooth muscles of blood vessels are regulated by the autonomic nervous system. Under the conditions of lower blood pressure, contraction of smooth muscles of blood vessels restore the reduced blood pressure. On the other hand, when the blood pressure rises above the normal range, the smooth muscles of blood vessels relax to dilate them and to lower down the blood pressure.

4 0
3 years ago
Help plzzz 10 points
labwork [276]

y(p - t) = 2pt.  

yp - yt = 2pt.  

yp = yt + 2pt.  

t = yp/(y + 2p).  

-John

8 0
3 years ago
Read 2 more answers
Trey and Connie were raising pigs for their 4-H project. The students fed their piglets a variation of two feeds: wheat and corn
Yanka [14]

Answer:

Trying to use the Scientific Method.

Explanation:

These two students are trying to make a experiment on these pigs they are raising. The reason why it is more like to attract the scientific method is because the steps were doing were based on it. (For example, they both might form a question and try different types of things to raise a pig)

Hope this helps, and have a wonderful day!!!

3 0
3 years ago
Other questions:
  • Energy produced from material that comes with living organisms is known as
    13·2 answers
  • In an analysis of a new bacterial species, a microbiologist finds that the bacteria has an outer layer comprised primarily of pr
    5·2 answers
  • A 33-year-old pregnant client asks the nurse about testing for birth defects that are safe for both her and her fetus. which tes
    6·1 answer
  • By what 2 different mechanisms could mutant phages change to become capable of lysing<br> e. coli k
    12·1 answer
  • Which occurs during the first stage of photosynthesis? A. Food for the green plant is made. B. Chlorophyll collects light energy
    8·2 answers
  • An earlier classification system grouped organisms by whether they inhabited the air, land or sea. However, the five-kingdoms-of
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Why is the movement of basic elements in<br> ecosystems different from the transfer of<br> energy?
    5·1 answer
  • treatment for PTSD campus be described A.multumodal multi-phasic b. atheoretical C. stress inclusion D.eclectic​
    13·1 answer
  • Phagocytosisthe ribosomal rna studies that led to the division of prokaryotic organisms into the bacteria and the archaea were b
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!