Answer:
1. Nucleus
2. Nuclear DNA
3. Chromosomes. They contain the DNA.
4. This is DNA. DNA contains the instructions needed for an organism to develop, survive and reproduce.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer: Why?
Explanation: I hope you are okay.
Answer:
The correct answer is - O and 6.9; 7.1 and 14
Explanation:
A measuring scale that tells about the acidity or basicity or alkaline nature of a particular object or solution is possible with the help of a pH scale that measures how acidic or basic a solution or object is.
It ranges between 0 to 14. pH less than 7 or ranging from 0.0 to 6.9 is acidic and more than 7 or from 7.1 to 14.0 is basic or alkaline in nature. A measure of the relative amount of H+ ion and OH- ions in water is pH.
The Coriolis Effect can be seen in action in the general circulation of the atmosphere. The winds at all latitudes to the north of 0° deflect to the right of their intended path in the Northern Hemisphere. The Coriolis Effect does not impact the wind speed, only the wind direction.