1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
4 years ago
14

A 75 year old man need a replacement heart valve .he lives alone and cares for himself .is a mechanical or biological heart more

suited for him
Biology
1 answer:
WITCHER [35]4 years ago
7 0
Biological heart is more suited for him
You might be interested in
Make a four linked food chain​
OLga [1]

Answer:

Grass -Grasshopper - Frog - Phyton - Eagle

6 0
2 years ago
Match the following: 1. the continuous movement of water between the Earth's surface and the atmosphere lead 2. pollutes water s
Nat2105 [25]

Answer:

Explanation:

1. Hydrological cycle: the continuous movement of water between the Earth's surface and the atmosphere.

2. Industry: pollutes water sources by dumping wastes in rivers, streams, and oceans.

3. Sewage: the leading cause of water contamination in countries without water treatment plants.

4. Agriculture: a source of water pollution caused by the overuse of pesticides and fertilizers.

5. Eutrophication: caused by an overabundance of organic matter in water supplies.

6. Putrefaction: the decomposition of organic matter by microorganisms

7. Pesticides: a chemical pollutant that can enter the water cycle through agricultural or domestic use.

8. Petroleum: can cause the contamination of underground water supplies if poured on the ground

9. Lead: a metal that leaks into water supplies via the soil or aging water systems.

10. Humoral immunity: depends upon the production of disease-specific antibodies to destroy harmful bacteria.

11. Stimulants: increases the activity of the central nervous system.

12. Depressants: reduces the activity of the central nervous system.

13. Bacterial infection: caused by the reproduction of a small infectious agent, which produces poisons that destroy cells

3 0
3 years ago
Maddie must illustrate the carbon cycle for Science class. Which diagram should Maddie draw to illustrate how energy transfers i
stiks02 [169]

Answer:

illustrate the carbon cycle

Explanation:

food web

8 0
2 years ago
Read 2 more answers
Distinguish between the contribution of genes and the environment to phenotypes
rusak2 [61]
<span>Gene experssion are influenced by enviroment. the best example is skin color in case of human for e.g if person with fair color or white complexion goes to africa or any part where sun exposure is more his or her color gets dark .the darking of skin is due to melanin production. see here person is same only difference is in enviromental condition due to which gene which are responsible for the production of melanin are produced.
I hope u understood it</span>
7 0
3 years ago
A cell contains Select one: a. one kind of enzyme that promotes thousands of different chemical reactions. b. thousands of diffe
Ann [662]

Answer:

The answer is letter B

Explanation:

A cell contains thousands of different kinds of enzymes, each promoting a different chemical reaction.

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is activation energy?
    7·2 answers
  • Julie is studying the clearing of tropical rain forests in Brazil. The land is being cleared for farming, but the poor quality o
    14·2 answers
  • All living things need food and a place to live. Which below is also something all living things need to live? A. a family B. wa
    12·2 answers
  • Which of the following areas of study do scientists NOT use to find support for evolution:
    15·1 answer
  • The oil spill resulting from the 2010 Deepwater Horizon disaster ________.A) is considered a minor incident compared to other oi
    12·1 answer
  • Suppose a bacterial infection kills off most of the prey at point B on the graph. How would this affect the predator and prey gr
    12·1 answer
  • My Activities
    15·1 answer
  • From the list below, choose the term that best completes each sentence and write it in the blank.
    12·1 answer
  • Why does a chameleon have a broad niche? explain <br> PLEAEEEEEE NEED HELP ASAP!!!!!!!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!