1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Setler79 [48]
4 years ago
14

A 75 year old man need a replacement heart valve .he lives alone and cares for himself .is a mechanical or biological heart more

suited for him
Biology
1 answer:
WITCHER [35]4 years ago
7 0
Biological heart is more suited for him
You might be interested in
What is one way kelp might affect pH
skelet666 [1.2K]

Answer:

kelp might affect pH by reducing it rate

3 0
2 years ago
Why are bacteria called the borderline between plants and animals​
tiny-mole [99]

Answer:

it's because they have the both characteristics of plants and animals

example:-

  • bacteria have cell wall that is a characteristic of the plants.
  • but at the same case they also produce some nucleic acids that are only found in animals.

so, they are the borderline between plants and animals.

Explanation:

brainliest plz

5 0
3 years ago
Please help meeeeee<br>​
igor_vitrenko [27]

Answer:

i am so sory! i cant see the picture

Explanation:

7 0
3 years ago
In which of the following can a change be directly observed? A. alleles B. genotypes C. phenotypes D. mutations
weqwewe [10]
Phenotypes can be directly observed. Phenotypes are the outward appearance of an organism that express the genotype. An example of a phenotype is hair color, or eye color.
4 0
4 years ago
Is a modular growth strategy better for capturing concentrated resources or widespread (dilute) resources? Briefly explain your
GalinKa [24]

Answer:

The modular type of strategic techniques are highly modular in their working and can be very useful for capturing concentrated resources or widespread (dilute) resources. The modular design in a capturing technique enhances the chances of better resource capturing whether it is concentrated or diluted.

The modular design works like it has several hands, that can perform all of their work by own greatly decreasing time required for capturing.

8 0
3 years ago
Other questions:
  • The first part of photosynthesis within the chloroplast occurs in the______and the second in the _____of the chloroplast
    14·1 answer
  • Which of the following properties describes a direct current system but not an alternating current system?
    7·1 answer
  • Aerobic respiration begins to function when ______________ or ______________ are oxidized.
    8·1 answer
  • The most important factor for regulating respiratory rate is
    5·1 answer
  • (NEED ANSWER ASAP)
    5·2 answers
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Can some one help me out please
    5·1 answer
  • What influences the appearance and function of skeletal muscles​
    14·1 answer
  • What are the relationship of living beings with environment​
    6·1 answer
  • In what way does heredity influence the environment
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!