Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
Humans require water for survival, so they tend to settle near areas with access to large amounts of water. Rainfall and water bodies such as rivers and lakes provide humans with clean water for drinking, cleaning, agriculture and recreational activities. Pollution of water supplies and population growth depletes aquifers leading to competition and waterborne diseases, especially in developing countries.
Climate patterns around the world influence human settlements. They live in conditions that favor their lifestyles and alter their clothing and housing in accordance with climate. In addition, extreme weather leads to sparsely populated areas and limit agricultural practices; for example, harsh and cold weather favor plants that can adapt to that environment.
Land formations such as mountains and hills shape transportation routes and networks, while the movement of tectonic plates on the Earth's surface sometimes causes hazards like earthquakes that destroy habitats, displace humans and affect the availability of water.
Fertile soil carries out numerous functions such as supporting life, recycling nutrients, regulating water and providing structural support for buildings. Humans extract minerals and perform recreational activities on the soil. Infertility creates deserts and leads to the migration of settlements.
A balanced ecosystem relates to better agricultural produce and less air pollution. Provision of food, safe water and clean air improves the well-being of living organisms.
Explanation:
Answer:
Prediction.
Explanation:
A prediction is often written as an if/then statement.
This ultimately implies that, a prediction is based on hypothesis that hasn't proven yet or isn't backed up by any evidence. Thus, it is typically an if statement that also leads to an outcome (then).
As a terrestrial planet with a thick nitrogen-oxygen atmosphere, Earth's appearance comes down to the light-scattering effect of our planet's atmosphere and our oceans, which causes blue light to scatter more than other colors because of the shortness of its wavelength.
D. The number of small farms<span> has decreased, and they are outnumbered by </span>large farms<span>.</span>
