1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedbober [7]
2 years ago
5

Which is associated with asexual reproduction.

Biology
1 answer:
umka21 [38]2 years ago
8 0
B and d erfff trjftghgft
You might be interested in
Where would you find methanogens, which can function only in the absence of oxygen? Select the correct answer. A. roots of plant
podryga [215]
I think the correct answer from the choices listed above is option B. You can find methanogens in the human intestines. These organisms can  work with or without oxygen. Too much of oxygen for them is toxic. They are obligate anaerobes.
4 0
3 years ago
Darwin called the ability of an organism to survive and reproduce in its enviorment
lana66690 [7]
Darwin called the ability of an organism to survive and reproduce in its environment fitness.
Some organisms were fit to do all of these things, whereas others were not. 
8 0
2 years ago
Read 2 more answers
NEED HELP.
gayaneshka [121]

Answer:

Clear cuts are areas from which every tree has been cut down and removed, in a shelterwood system the old stand is removed in a series of cuttings to promote the establishment of an essentially even-aged new stand under the shelter of the old one, and uncut forests are just your average wild woods, left alone and was never bothered with.

for a simpler answer: clear cuts are clear areas, shelter wood are slight cuts, removing some trees for an environment such as parks and backyards, and uncut forests are wild forests that has no trees cut down.

7 0
2 years ago
Read 2 more answers
The endometrium of most mammals is prepared to receive a developing embryo by hormones
anygoal [31]

Answer:

Implantation, gestation, and birth. Reproductive patterns in placental mammals are diverse, but in all cases a secretory phase is present in the uterine cycle, and the endometrium is maintained by secretions of progesterone from the corpus luteum.

PLEASE SAID THANKS

4 0
3 years ago
Which of the following are TRUE statements about red blood cells (erythrocytes)?
Romashka [77]

Answer:

The correct answer will be options A, B and E.

Explanation:

Red blood cells or RBC or erythrocytes are the cells present in the connective tissue which forms the blood. RBC perform various functions in the body but the primary function is the transport of the gases in the body.

The RBC are continuously formed in the bone marrow region of the bone form the hemopoietic stem cell found in the bone marrow. These cells produce a large amount of RBC that is about  2 million cells per second in a healthy adult.

When RBC are formed posses nucleus but when mature, they lack nucleus that is genetic material and organelles like mitochondria so, they are not able to divide.  

These RBC contain haemoglobin in their cytoplasm which shows high affinity to bind oxygen and low affinity to bind carbon dioxide to the iron group of haemoglobin.

Thus, options A, B and E are the correct answer.

3 0
3 years ago
Other questions:
  • why do you think the deer population in 1905 was 4,000 even though the carrying capacity was predicted to be 30,000
    12·1 answer
  • Est ce que ça arrive que tu as enceinte epuis tu a de période
    14·1 answer
  • The combining form “thrombo” refers to clotting of the blood. Which term refers to a disease of blood-clotting cells? thrombolep
    14·2 answers
  • Which statement below best describes how biodiversity contributes to the sustainability of an ecosystem?
    7·1 answer
  • Analysis Questions: 1. What is the function of plant roots? 2. What is the function of root hairs? 3. What plant tissue are root
    12·1 answer
  • URGENT: (Blank) is an well-tested explanation that tries to answer a “why” question of the natural world.
    5·1 answer
  • Will give brainllest if right
    5·2 answers
  • Which mutation in a fruit fly could be passed on its offspring?
    14·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which is most responsible for the synchronized contraction of cardiac muscle tissue?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!