1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gizmo_the_mogwai [7]
3 years ago
5

¿Qué tejido se encarga del movimiento?

Biology
1 answer:
Alinara [238K]3 years ago
8 0
Lo siento mucho, pero no sé cuál es tu pregunta o qué prueba tienes
You might be interested in
Off the coast of Ecuador, cold, nutrient-rich water rises from below. which of the following best describes this current?
tia_tia [17]
The answer is b good luck hope I helped
3 0
4 years ago
Read 2 more answers
RNA is a double helix?
Nookie1986 [14]

Answer:

RNA is a single strand so no

5 0
3 years ago
A(n) ______ agent would be used to destroy bacteria on a countertop whereas a(n) _______ agent would be used on skin prior to ma
34kurt
Disinfectant, antiseptic
3 0
2 years ago
What causes our seasons?
padilas [110]

Answer:

Seasons occur because Earth is tilted on its axis relative to the orbital plane, the invisible, flat disc where most objects in the solar system orbit the sun. ... In June, when the Northern Hemisphere is tilted toward the sun, the sun's rays hit it for a greater part of the day than in winter.

4 0
3 years ago
Read 2 more answers
Which of the following is TRUE about Earth's plates?
Mars2501 [29]

forgot a pic cant help if ion have a visual

5 0
3 years ago
Other questions:
  • After a partial gastrectomy or pyloroplasty, clinical manifestations that include increased pulse, hypotension, weakness, pallor
    12·1 answer
  • What is the type of microscope that uses a series of magnifying lenses
    15·1 answer
  • Which of the following is a subsurface event that takes place during the rock cycle?
    5·2 answers
  • Please help me quickly please!! ✨
    10·1 answer
  • Animals are often grouped as A. vertebrates or invertebrates. B. heterotrophs or autotrophs. C. walkers or crawlers. D. swimmers
    15·2 answers
  • If a genetically based attraction to beautiful people contributes to survival, that trait will likely be passed on to subsequent
    8·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • How is eubacteria organized?
    5·1 answer
  • What kind of rock would you expect continental plates to be made of? *
    5·2 answers
  • What two characteristics of life are described in the following statement? “A human begins life as a single cell, whereas an adu
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!