1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
3 years ago
12

Is unicellular eukaryotic or prokaryotic

Biology
2 answers:
Nataliya [291]3 years ago
8 0

Answer:

It's Eukaryotic

Explanation:

andre [41]3 years ago
7 0
Prokaryotic, eukaryotic cells are more complex and have a nucleus, they are multicellular organisms , Prokaryotic cells are unicellular and are less complex
You might be interested in
Select the correct location on the map.
lisov135 [29]
The answer is e catabolism
4 0
3 years ago
Read 2 more answers
Are endocytosis and exocytosis forms of passive or active transport
PolarNik [594]

Active transport requires energy, whereas passive doesn't.

Both Endocytosis and Exocytosis are transports that require energy from the cell in order to transport particles. Therefore, they're forms of active transport.

5 0
3 years ago
A scientist was investigating why several fish caught from a local stream displayed similar mutations. He found that the water t
Sindrei [870]

Answer: Increased water temperature caused by the industrial plant.

Explanation: this is explained in the text lol.

5 0
3 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
About how many pieces of evidence should you have to create a successful CER?
ollegr [7]
It’s 3-5 because you have to have 1. Claim 2. Evidence and 3. Reasoning
5 0
3 years ago
Read 2 more answers
Other questions:
  • Which statement best describes embryonic stem cells?
    10·1 answer
  • What was the full name of the study and what was it intended to examine? "Miss Evers' Boys"
    8·1 answer
  • When does diversity in species occur
    7·1 answer
  • At rest, the membrane of the cell is slightly permeable to ___________________, the positively charged ion that is most responsi
    15·1 answer
  • The pen on a seismograph swings freely. True or false
    15·2 answers
  • During times of sexual arousal, the sperm leave their storage area and travel into long tubes called the
    15·1 answer
  • Wind is caused by
    8·2 answers
  • Which of the following statements best describes the major difference between anaphase of mitosis and anaphase I of meiosis?
    8·3 answers
  • What’s the answer for number 4?
    12·1 answer
  • Why do some animals migrate in and out of the coniferous forest?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!