1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lilavasa [31]
3 years ago
9

In a cell, what does the nucleus organelle do?

Biology
1 answer:
chubhunter [2.5K]3 years ago
8 0
It contains the DNA and control the cell :)
You might be interested in
PLEASE HELP ASAP!!! I WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!
ella [17]

Answer:

This is your mom you need to find your answers with out cheating!!!!!!!!

Explanation:

7 0
2 years ago
Areas with relatively little wind.
denis-greek [22]
My guess would be areas that have very little flat lands. probably your forest. sorry if this doesnt help
5 0
2 years ago
True or false RNA is synthesized from viral DNA in an infected cell before protein synthesis begins.
Nuetrik [128]
False because <span>Like DNA, RNA is assembled as a chain of </span>nucleotides<span>, but unlike DNA it is more often found in nature as a single-strand folded onto itself, rather than a paired double-strand. Cellular organisms use </span>messenger RNA<span> (</span>mRNA<span>) to convey genetic information.</span>
4 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Sometimes we call "clean energy"<br> *<br> A) Fossil fuels B) Petroleum C) green energy
m_a_m_a [10]
Answer:
C) Green energy
7 0
3 years ago
Other questions:
  • Which is the correct series of events in the evolution of life on earth?
    11·1 answer
  • How can meteorologists use the jet stream to predict the weather
    6·2 answers
  • A student notices that when bananas are kept near other fruits, the other fruits ripen faster. She wonders what causes the other
    5·2 answers
  • Aerobic exercise refers to physical activity that
    15·2 answers
  • Study the picture above. Based on what you leared in this unit, correctly match the type of plate
    13·1 answer
  • What is the evidence that supports the autogenic hypothesis?
    11·1 answer
  • How humans changed the balance of the park ecosystem.
    7·1 answer
  • Awnser or comment if you think i should do a face reveal
    10·2 answers
  • The term that refers to the physical appearance of an individual with respect to gene expression for a
    6·2 answers
  • Se puede afirmar que gracias a la evolución las especies facilito la adaptacion de todos en el planeta
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!