1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blsea [12.9K]
3 years ago
14

Why does secondary session occur faster them primary secession

Biology
1 answer:
Gre4nikov [31]3 years ago
4 0

Answer:

During secondary succession, the soil isn't damaged hence there is no need for pioneering species such as lichens to dissolve the damaged soil into organic ones that can sustain more complex plants.

Explanation:

Secondary succession, type of ecological succession (the evolution of a biological community’s ecological structure) in which plants and animals recolonize a habitatafter a major disturbance—such as a devastating flood, wildfire, landslide, lavaflow, or human activity (e.g., farming or road or building construction)—significantly alters an area but has not rendered it completely lifeless. Secondary succession is distinguished from primary succession, in which a biological community develops where no life had existed

Secondary succession, type of ecological succession (the evolution of a biological community’s ecological structure) in which plants and animals recolonize a habitatafter a major disturbance—such as a devastating flood, wildfire, landslide, lavaflow, or human activity (e.g., farming or road or building construction)—significantly alters an area but has not rendered it completely lifeless. Secondary succession is distinguished from primary succession, in which a biological community develops where no life had existed previously.

Secondary succession follows a major disturbance, such as a fire or a flood. The stages of secondary succession are similar to those of primary succession; however, primary succession always begins on a barren surface, whereas secondary succession begins in environments that already possess soil. In addition, through a process called old-field succession, farmland that has been abandoned may undergo secondary succession.

Secondary succession takes place where a disturbance did not eliminate all life and nutrients from the environment. Although fire, flooding, and other disturbances may bring visible ruin to a landscape, drive out many plants and animals, and set back the biological community to an earlier stage, the habitat is not lifeless, because the soil retains nutrients and seeds that were set down before the disturbance occurred. Buried seeds can sprout shortly after the effects of the disturbance pass, and some may have greater success from reduced competition and reduced shading. Some species may be adapted to the frequent passage of a particular disturbance. For example, the jack pine (Pinus banksiana), a tree species common in the northeastern U.S. and Canada, requires heat from a wildfire to open its cones (strobili) before seeds can be spread for new growth.

You might be interested in
Where do producers get their energy?
jekas [21]
The answer is B sunlight
4 0
2 years ago
Read 2 more answers
Water changes from a liquid to a gas in the process of evaporation
Rudiy27
Your answer is true lol  hope that helped
8 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
How is a cell a system , ANWSER IN YOUR OWN WORDS ?
-BARSIC- [3]

Explanation: the movement of organelles and other substances within cells. Endoplasmic reticulum

5 0
3 years ago
What are the four classes of cloud based on altitude? What does each prefix mean?
yulyashka [42]
There's the cumulus, the stratus, cirrus, and nimbus.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Can some one code this dna
    15·1 answer
  • Why its important that skull joints cannot move
    9·1 answer
  • The alpha helix and beta pleated sheet represent which level of protein structure?
    10·1 answer
  • Given the DNA strand GAATTCCTCGAG, what would be the complimentary strand to make the double stranded DNA? How do you get the an
    5·1 answer
  • To determine the evolutionary relationships among organisms scientist compare what
    5·2 answers
  • PLS PLS HELP ITS BIOLOGYYYYY
    12·2 answers
  • Please choose the best description, or definition for Principle of Fossil Correlation. states that rock layers with the same uni
    14·2 answers
  • R it answe know it dont If you dont
    9·1 answer
  • Summarize your findings in a brief essay. Your essay should include two parts Science class project weather forecasting
    12·1 answer
  • Name any two equipment based on atmospheric pressure​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!