1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hjlf
3 years ago
13

Newton’s second law states that force is equal to?

Biology
2 answers:
kicyunya [14]3 years ago
7 0

The force acting on the object is equal to the mass of that object times it's acceleration.

mamaluj [8]3 years ago
6 0
Force is equal to mass
You might be interested in
What is the membrane that covers the eye of a frog?
Elenna [48]
The nictitating membrane
5 0
3 years ago
List three primary categories of freshwater use.
slamgirl [31]

Answer:

It can be used for washing hands washing cars and filling swimming pools.

Explanation:

5 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
The endocrine system regulates the body through hormone release. Like the nervous system, what does the endocrine system help ma
Oliga [24]

Answer:

How is the endocrine system related to the nervous system in terms of its regulatory activity?

For one, the endocrine system uses chemical signaling (hormones, produced by glands) while the nervous system uses electrical signaling (neural impulses). The signal transmission of the nervous system is fast because neurons are interconnected, but the functions are more short-lived.

Explanation:

5 0
3 years ago
What type of rock is formed due to the cooling and solidification of magma?
Ivahew [28]

Answer:

igneous rocks

Explanation:

6 0
3 years ago
Other questions:
  • The role of chlorophyll in photosynthesis is to A. Pass electrons to the stroma B. Split water molecules C. Absorb light energy
    7·2 answers
  • Two atoms that are isotopes of one another must have the same number of what? Electrons, All Particles, Protons, or Neutrons
    14·2 answers
  • Explain how animal stem cells are different from plant stem cells
    14·1 answer
  • Mammals in Australia are called marsupials, and diverged from the placental mammals very early in mammalian evolution. Australia
    8·1 answer
  • The respiratory system is made up of the airways, lungs, and respiratory muscles. The lungs are classified as –
    14·2 answers
  • How does convention occur in the troposphere
    5·2 answers
  • The BEST use of the food pyramid would be __________.
    5·2 answers
  • Describe the dna structure using the terms nucleotides, backbone, and orientation.
    12·1 answer
  • Which particles can pass through the cell membrane
    9·1 answer
  • Plz help thx
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!