"Provide opportunities for increased trade with the United States" is the one among the following choices given in the question that is not <span>a goal of ASEAN members. The correct option among all the options that are given in the question is the third option or option "C". I hope the answer has helped you.</span>
Correct answer: Option D- DNA ligase
Explanation: In option A, thymine is a nucleotide, so it is present throughout the replication process, wherever it is required. It is added to the newly formed DNA. In option B, Helicase enzyme is active during initiation and elongation stage, as it facilitates the opening of the winded DNA strands. Option C is nucleotidase and it has no role in DNA replication. So, the correct answer is DNA ligase, which is option D.
The okazaki fragments formed during DNA replication are sealed at the end. And in this step, DNA ligase is used. It catalyzes the formation of phosphodiester bond between the nucleotides of okazaki fragments. So it is the last active molecule of the process.
Your answer would be Neptune. The planet can cause wind-speeds of frozen methane of up to 1,200 mph.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.