In the given case, the person Chad is suffering from hepatitis.
Hepatitis refers to the inflammation of the liver. The viruses are the prime causes for the majority of hepatitis cases. The kind of hepatitis is named for the virus, which causes it, like hepatitis A, hepatitis B, or hepatitis C. Some of the common symptoms of hepatitis are:
1. Loss of appetite
2. Fatigue
3. Mild fever
4. Joint or muscle pain
5. Pain in the belly and nausea and vomiting
Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
Hello!
Taxonomy is A. The science of classification.
It is the science of defining, naming, classifying, and describing living and extinct organisms.
Plant cells are a form of eukaryotic cells with true nucleus and organelles. Various types of plant cells are -xylem cells, phloem cells ,parenchyma cells, collenchyma cells and sclerenchyma cells. These cells distinguish plants from animal kingdoms.
In desert plants like cactus, they have an exquisite set of adaptations for optimal water management. They have thickened stem tissues with thin-walled parenchyma cells so a lot of water can be stored in stems.
