1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
2 years ago
15

Which pair of molecules both contain carbon atoms?

Biology
1 answer:
77julia77 [94]2 years ago
7 0
Proteins and fats i believe... Its been awhile.
You might be interested in
Any electricity charged object crates an electric field.Walking across carpet In wool socks can create charge.This observation i
Naya [18.7K]

Answer:

The observation is an evidence of static electricity.

Explanation:

Static electricity refers to the stationary electric charge that is produced by friction. In other words, this kind of electricity is created when objects (2 objects for example) that are not good conductors of electricity are rubbed together.

During the rubbing process, electrons from the objects come in contact leading to the creation of a stationary electric charge. A good example of static electricity is when you are combing your hair and you see a spark in the mirror.

6 0
3 years ago
Compare and contrast at least two different ways human activity affects the ecosystem both positively and negatively
kozerog [31]

Answer:

Got dis

Explanation:

When humans mass produce items for others to buy, those factories that make that stuff release carbon dioxide into the atmosphere which kills the ozone layer (the ozone layer basically protects everything on this planet from the suns dangerous UV rays). On the other hand humans try to help out the environment for example those cars that people use that use electricity and not fossil fuels as energy for the car and the fossil fuels have the same affect as the factories but the electricity does not release the fumes that the fossil fuel cars do. Hope this answers your question!

8 0
3 years ago
The total energy available in a good web...
tekilochka [14]

Answer: A

Explanation:

5 0
3 years ago
Read 2 more answers
How long does it take the moon to go through all of its phases
polet [3.4K]

Answer:

27 days

Explanation:

It takes 27 days, 7 hours, and 43 minutes for our Moon to complete one full orbit around Earth. This is called the sidereal month, and is measured by our Moon's position relative to distant “fixed” stars. However, it takes our Moon about 29.5 days to complete one cycle of phases (from new Moon to new Moon).

4 0
2 years ago
Read 2 more answers
Why dont children look exactly like their parents?
Illusion [34]

Answer:

because parents only give the child 1/2 of their chromosomes

Explanation:

8 0
2 years ago
Read 2 more answers
Other questions:
  • Over-arching theories are so important because they help scientists choose their methods of study and mode of reasoning, connect
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • How is industrial land use different from other land uses in terms of water?
    15·2 answers
  • Which of the following is NOT a function of the cerebellum? A. . control of posture, locomotion, and fine motor coordination B.
    15·1 answer
  • Broadleaf deciduous trees of temperate forests A) Have small leaves to conserve energy. B) reabsorb chlorophyll, resulting in th
    13·1 answer
  • List one property that water and oil do not share.
    8·1 answer
  • What do these three objects have in common?<br><br> Blind - Expiry - Due
    5·1 answer
  • All life processes occur within cells. *<br> 10 points<br> True<br> False
    9·2 answers
  • How does natural selection cause populations to change over time.
    15·1 answer
  • Brendan made a chart to categorize the characteristics of animals.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!