1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
9

If two molecules of DNA formed during replication are different, what has happened?

Biology
2 answers:
tangare [24]3 years ago
8 0
The answer would be transcription! (:
skelet666 [1.2K]3 years ago
7 0
The answer B. transcription
You might be interested in
Please im in class right now
Alexus [3.1K]
As seen in the video game death stranding.
Two extinction level events happened and wiped out half of all human life. Building and cars and homes were destroyed and replaced by growling grass or dirt. A new species of bug came about called a cryptobite and a bridge was formed between the world of living and dead and hence forth came the rise of beached things
4 0
3 years ago
Which of the following is true of hydrogen bonds
Schach [20]
B. Hydrogen bonds make the positive sides of water molecules stick to each other
6 0
3 years ago
Which of the
trasher [3.6K]

Answer:

A. intrusive igneous rock

Explanation:

6 0
4 years ago
Read 2 more answers
How do veins keep blood moving
GenaCL600 [577]

Answer:

The return of blood to the heart is assisted by the action of the skeletal- muscle pump. As muscles move, they squeeze the veins running through them. Veins contain a series of one-way valves, and they are squeezed, blood is pushed through the valves, which then close to prevent backflow.

8 0
3 years ago
Read 2 more answers
Which muscle group name and function is correctly matched? select one:
motikmotik
Fixator (--) helps hold a bone in place
8 0
3 years ago
Other questions:
  • What benefits are associated with Magic Johnson's announcement concerning his HIV-positive status? What risks or drawbacks can y
    5·1 answer
  • SO OK i have been very sick here lately my upper stomach has been killing me
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Identify the pictures as heterogeneous or homogenous?
    14·1 answer
  • WILL MARK U AS BRAINLIST
    5·1 answer
  • Define asexual reproduction. Describe two methods of asexual reproduction in animals.
    13·1 answer
  • Which statements best describe the first stage of cellular respiration? Select three options. The stage happens in cytoplasm. Th
    8·2 answers
  • If I mix red, blue, and green light equally I get white light. Would the same thing happen if I mix the same colors in paint? Wh
    11·2 answers
  • One of the functions that related to the circulatory
    6·1 answer
  • An ion with six protons, seven neutrons, and a charge of 2+ has an atomic number of
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!