1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
15

Shelly wants to find the speed that her dog can run. What should Shelly do?

Biology
1 answer:
Kipish [7]3 years ago
3 0

Answer:

measure the time it takes for a dog to run a certain distance

You might be interested in
Which word best describes the tone of the excerpt? A. mysterious B. mocking C. frustrated D. troubled
Taya2010 [7]

Answer:C. frustrated

Explanation:

5 0
3 years ago
What is the relationship between a protein, the cell, and DNA?
jek_recluse [69]

Answer:

B. Protein is composed of DNA which is produced in the cell

Explanation:

5 0
2 years ago
Read 2 more answers
Hydrothermal vents are often rich in metals, such as copper, and also host dense populations of marine organisms. Which of the f
nydimaria [60]

The answer is copper. Nonrenewable resources are those that cannot be readily/naturally replaced at rates that match those of consumption (an aspect that allow renewable resources to be sustainable). Copper are made deep in earth at very slow rates hence do not readily renew themselves. Organisms, on the other hand die, and are naturally replaced by offspring.

4 0
3 years ago
Cardiac muscle cells undergo continuous aerobic respiration, are called the most energetic cells in the body, and therefore cont
lubasha [3.4K]
First blank - mitochondria
Second blank - ribosomes
5 0
3 years ago
If the sympathetic nervous system increases the production of saliva, the parasympathetic system _____. A. increases more B. dec
mario62 [17]
C. Increases peristalsis. 
5 0
3 years ago
Other questions:
  • How does phospholipid structure relate to the selective permeability of the plasma membrane? A critical feature of the plasma me
    10·1 answer
  • In the 1900s, many hydroelectric dams were built in order to hamess the energy of moving water. The dams supplied a clean source
    6·1 answer
  • Select all that apply.
    11·2 answers
  • Describe the process of scientific inquiry and explain why it is not a rigid sequence of steps.
    7·1 answer
  • The nerves that are responsible for converting tactile stimuli into electrical signals that the brain can understand are called
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • When treating chlamydia,
    12·1 answer
  • Help me please!!!!!!!! :( Past due!!!! No websites/ links/ inappropriate answers or your reported. Worth 20 points please look a
    11·1 answer
  • A biology teacher asks his class to make models of a plant cell, an animal cell, and a bacterial cell. Aside from cytoplasm and
    15·1 answer
  • What is the net charge of the structure in the figure below?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!