1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
7

I will mark as the brainliest answer​

Biology
1 answer:
yuradex [85]3 years ago
7 0
1) Weather services gives up to 8 hours of watch time because its just a prediction and might not be accurate

2) Necessary precautions is when there is a dangerous weather alert coming towards you and you need to go for safety

3) When theres a warning, it means to look out for something and be safe at the same time
You might be interested in
While performing the acid-fast stain procedure, you heat your fixed bacteria with carbolfuchsin for 5 minutes, let the slide coo
Lilit [14]
In the acid-fast or Ziehl-Neelsen stain, following the referred washing, the slide should be covered in 1%-3% acid alcohol to decolourise until the smear turns into light pink. After that, wash well with clean water to stop the decolourisation.
5 0
3 years ago
Read 2 more answers
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
In what way do octopus respond to changes in it environment?
USPshnik [31]
If you mean the change in water Temperature then they simply just go on in life, they are very adaptable creatures.   
5 0
3 years ago
Which organelle carries out cellaur respriation?
Gre4nikov [31]
The mitochondria carry out cellular respiration.
7 0
3 years ago
Evolution of life on Earth can be most strongly linked to which of the following geological events?
goldenfox [79]
Movement of lithospheric plates created isolation between populations and with isolation comes different mutations and lineages which is how evolution occurs. (This is called allopatric speciation!).
5 0
3 years ago
Other questions:
  • Quick help needed!
    5·1 answer
  • Both liquids and ___ exert a buoyant force
    10·2 answers
  • Which of the following is not controlled at the individual level?
    9·1 answer
  • Which scientific skill involves sharing what you have learned with others
    6·1 answer
  • Rna and dna are which type of macromolecule
    12·2 answers
  • If a lipid bilayer is at least 108 times less permeable to K ions than it is to water, how do the K ions that are needed for man
    11·1 answer
  • A biological cycle, or rhythm, that is approximately 24 hours long is called a(n) ________ cycle
    6·1 answer
  • What are the oceanic features and functions
    15·2 answers
  • Lab report exercise and homeostasis
    10·1 answer
  • The genome of D. melanogaster consists of approximately 1.7 * 108 base pairs. DNA synthesis occurs at a rate of 30 base pairs pe
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!