1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Feliz [49]
2 years ago
5

How are various components of the blood adapted to function​

Biology
1 answer:
Cerrena [4.2K]2 years ago
5 0
I cant see the picture
You might be interested in
Sunflowers have specialized cells that enable the sunflower to track the
Molodets [167]
B. i searched it up
7 0
3 years ago
Which processes help return water to the oceans and lakes?
adelina 88 [10]

Answer:

3

Explanation:

not 100 percent sure but i think so

8 0
3 years ago
Read 2 more answers
What is an enzyme in biology
zysi [14]

Answer:

enzyme

Explanation: enzyme is produced by a living substance which acts like a catalyst to bring about a specific biochemical reaction

7 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Name five nutrient deficiency disea<br>se in human​
AnnyKZ [126]
I have 6 but here they are:

01.) Iron Deficiency

02.) Iodine Deficiency

03.) Vitamin B Deficiency

04.) Vitamin B12 Deficiency

05.) Calcium Deficiency

06.) Vitamin A Deficiency
3 0
3 years ago
Other questions:
  • Two major differences in the morphology of spermatids and spermatozoa
    8·1 answer
  • Why does sexual reproduction result in more genetic variation than asexual reproduction?
    11·1 answer
  • What are the similarities between photosynthesis and aerobic and anaerobic respiration?
    11·1 answer
  • 2. What does a cell need in order to live?
    13·2 answers
  • Pick the correct match.
    8·2 answers
  • Each organism in a population produces more offspring than can survive. This is called .
    5·1 answer
  • how do the similarities in the fore limb bones of humans,cats,dolphins, and bats support the theory of evolution?
    9·1 answer
  • How have plants and animals adapted in the biome
    15·1 answer
  • What is a zygote?
    6·1 answer
  • Present and debate current social and ethical implications of biotechnology and genetic engineering
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!