1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
3 years ago
7

How does wildfires relate to succession

Biology
1 answer:
navik [9.2K]3 years ago
6 0
The depletion of wilderness, opening up to the market
You might be interested in
Crude oil is composed of: a. Fatty acids c. Metal oxides b. Hydrocarbons d. Halogens
xeze [42]

crude oil is composed of B. Hydrocarbons


4 0
3 years ago
Suppose the light converged before reaching the back of the eye.
Schach [20]

Answer:

z

Explanation:

6 0
3 years ago
Why do different parts of the planet receive varying amounts of water?
fredd [130]

it helps the plant develop healthier

6 0
3 years ago
For children with most physical disabilities and other health impairments, a common cause of academic difficulties is
Ber [7]

For children with most physical disabilities and other health impairments, a common cause of academic difficulties is erratic or irregular school attendance.

Class attendance or school attendance is very important for your academic carrier because if you are not able to attend the class, you did not learn anything, you did not finish your homework etc. and when the exams came you did nothing. So, the children with physical disabilities or other health issues mostly misses the class due to health issues, and this irregular attendance causes difficulties in academic carrier.

<span> </span>

5 0
3 years ago
Examples of newton’s second law?
Phantasy [73]
If you push a truck and push a car with the same force, the car will have more acceleration than the truck, because the car has less mass.
It is easier to push an empty shopping cart than a full one, because the full shopping cart has more mass than the empty one.
6 0
3 years ago
Other questions:
  • Which two body systems must directly interact for vertebrate organisms to exchange gases?
    15·2 answers
  • Choose THREE human activities that have a negative impact on the biodiversity within Amazon rainforests.
    8·1 answer
  • Explain Hertzspeung-Russell diagram relationship to stars life cycles
    10·1 answer
  • Select all that apply.
    8·2 answers
  • Recently discovered remains from the tugen hills, dated to about 6 million years ago have been placed in which genus?
    11·1 answer
  • during asexual reproduction in a yeast cell ,two daughter buds are formed . what is true about the daughter buds formed in the p
    11·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Scientific research about the carbon cycle and global warming would be most valuable if the results
    11·1 answer
  • Hiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii
    15·2 answers
  • What is immigration?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!