1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
klemol [59]
3 years ago
8

What does transformant progeny mean

Biology
2 answers:
qwelly [4]3 years ago
8 0

Answer:

Package the desired genetic material into a suitable plant virus and allow this modified virus to infect the plant. If the genetic material is DNA, it can recombine with the chromosomes to produce transformant cells.Explanation:

chubhunter [2.5K]3 years ago
4 0

Answer: Viral transformation (transduction): Package the desired genetic material into a suitable plant virus and allow this modified virus to infect the plant. If the genetic material is DNA, it can recombine with the chromosomes to produce transformant cells.

Explanation:

You might be interested in
An allergic reaction to certain types of natural unprocessed foods such as peanuts is caused by
ANEK [815]
Your immune system protects you from bacteria and viruses. Sometimes it misreads a harmless substance as a threat. When that happens, your body creates chemicals, like histamine, that trigger an allergic reaction. It's unclear what causes your immune system to make the mistake about certain things.
6 0
4 years ago
During an infection, _____ are mobilized in large numbers from the bone marrow to fight pyogenic bacterial infections.
Degger [83]
The answer is Neutrophils
3 0
4 years ago
Explain how fossil fuels are formed from living organisms on land and in sea.
motikmotik
The substances that make up plankton and plants are converted into fossil fuels. Plankton breaks down into natural gas and petroleum, while plants are turned into coal. As it is now, by coal mining and exploration of oil and gas wells on land and offshore, humans harvest these resources.
8 0
3 years ago
HELP! Will give brainly!!<br><br> What happens when an antibody and antigen react?
laiz [17]
It causes pathogens to stick together.
8 0
3 years ago
Read 2 more answers
Which of the following characteristics would NOT increase or decrease the fitness of the organisms that possess it? a. Certain m
elena-14-01-66 [18.8K]

Answer:

maybe for me is answer is c

6 0
3 years ago
Other questions:
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • In the near future gene therapy may provide cures for genetic disorders such as severe combined immunodeficiency or cystic fibro
    6·2 answers
  • Which of the following is an important difference between climate and weather?
    9·2 answers
  • The presence of an epiphyseal plate indicates that _______ the bone is broken. the bone is dead. the bone is increasing in diame
    13·1 answer
  • What does biosynthesis produce?
    14·1 answer
  • 19. In bears, black fur is dominant to blonde fur. If a pure blonde bear is crossed with a
    14·1 answer
  • About how long did it take to grow the last 20 cells?
    14·1 answer
  • 5. Which is the complimentary DNA strand of the DNA strand:
    9·1 answer
  • Please help me its due in 20 minutes
    14·2 answers
  • In which type of plate boundary would you NOT find volcanoes?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!