1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Citrus2011 [14]
3 years ago
14

Before scientists can manipulate DNA they must first do a DNA extraction what is done during this process?

Biology
1 answer:
Natasha_Volkova [10]3 years ago
8 0

break the cells open to collect the dna.
seperate the dna from proteins and cellular debris.
precipitate the dna with an alcohol.
clean the dna.
look at the concentration and quality of the dna. 
You might be interested in
Scientifically, describe the shape of a DNA molecule.
galben [10]
The double helix is a description of the molecular shape of a double-stranded DNA molecule. In 1953, Francis Crick and James Watson first described the molecular structure of DNA, which they called a "double helix," in the journal Nature.
8 0
2 years ago
A lung cell had 26 chromosomes, how many chromosomes would the sex cells of that organism have?
Lorico [155]

Answer:50

Explanation:

3 0
3 years ago
Read 2 more answers
In the Scientific Method, after you make an observation and ask a question, what comes next?​
astra-53 [7]
Formulate a Hypothesis
5 0
3 years ago
Read 2 more answers
Enzyme found in retroviruses that produce dna from an rna template. True or False
grandymaker [24]

Answer:

<h2>True</h2>

Explanation:

1 .Reverse transcriptase (RT) is an RNA-dependent DNA polymerase enzyme which makes DNA from RNA..  

2. RT makes double-stranded DNA molecules from ssRNA ( single stranded RNA) molecule using it as a template.

3. Retroviruses like  HIV contain Reverse transcpritase (RT) enzyme, which uses the RNA molecule as template and make DNA from it and after that, virus make multiple copies of itself.

4. Reverse transcriptase enzyme make DNA reverse transcrptionally from RNA the process known as RNA dependent DNA polymerase.

5. It was  first discovered in retroviruses.

7 0
3 years ago
What is the most accurate description of the structure labeled B?
ANEK [815]
The correct answer is B. Thymus gland: enables immature lymphocytes to mature into T cells
6 0
3 years ago
Read 2 more answers
Other questions:
  • In corn, a dihybrid for the recessives a and b is
    6·1 answer
  • Describe how viruses and prions can alter cell functions
    12·1 answer
  • ~PLEASE HELPP~ Burning fossil fuels causes a movement of carbon from the
    8·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Please i need your help
    15·1 answer
  • 2. What is the mass of a space rock on Earth that has a weight of 16.8 N?
    15·2 answers
  • Water molecules are ____ due to _____ bonding. This property helps water molecules to stick to each other and allows for the mov
    7·1 answer
  • 8. What does the term aromatic imply about an organic molecule​
    10·1 answer
  • The photograph shows a community. What kind of community is most likely shown?
    13·1 answer
  • Why is Glucose added to the fermenter with bacteria Becillus magaterium
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!