1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Simora [160]
3 years ago
11

Which bodies of water are in the eastern united states

Geography
1 answer:
Ede4ka [16]3 years ago
6 0

The contiguous United States are framed by three major bodies of water: the Atlantic Ocean on the east coast, the Pacific Ocean on the west and the Gulf of Mexico to the south. The Pacific also holds the Hawaiian Island chain. The Gulf stretches from Texas to Florida and also touches Alabama, Louisiana and Mississippi.

You might be interested in
If the area of a circle is 58 square feet , find the circumference
sesenic [268]
The circumference of that circle is about 27.02.
6 0
3 years ago
Read 2 more answers
Which CDE contest requires students to use their sensory skills to solve problems and make sound decisions?
yanalaym [24]

Answer:

the answer is A Milk Quality and Products

Explanation:

iCVE 2021

7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
GIVING CROWN!!!! 50 Points for quick Answer!!!
taurus [48]
C. Pennsylvania because it is close to newyork and can have similar cultures
3 0
3 years ago
Read 2 more answers
Choose the FALSE statement about minerals. A. They form naturally. B. They make up rocks. C. They are solids or liquids. D. They
Oksana_A [137]

C is the false answer.

8 0
3 years ago
Other questions:
  • Imagine that a new community is being developed on the outskirts of your neighborhood. As a professional working in your chosen
    10·2 answers
  • When was Trajan born
    13·2 answers
  • What would happen if the amount of precipitation, runoff
    10·2 answers
  • The highest point in the United States, Mount McKinley, is in the state of
    15·2 answers
  • What led to the quebec act and what were the effects of its passage
    13·1 answer
  • At some point in their recent history, all of the following countries became divided into two political entities as a result of
    8·2 answers
  • Martin gave the cashier $10 to pay for 4 candy bars. The cashier gave her $5.24 in change. Each candy bar cost the same amount.
    6·2 answers
  • Draw and label the cross section of the Earth's interior​
    10·1 answer
  • (PLEASE HELP!!) What is an organism that gets its energy from other plants or other animals.
    13·2 answers
  • Explain how carbon capture and international agreements may help to reduce the rate of climate change. (4 marks)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!