1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mekhanik [1.2K]
3 years ago
13

Most viruses.... can use host machinery to produce more of themselves are persistent and innocuous within host cells switch betw

een pathogenic and non-pathogenic modes of existence kill the cell they infect are rarely found in the natural world.
Biology
1 answer:
Novay_Z [31]3 years ago
7 0

Answer: Most viruses can use host machinery to produce more of themselves

Explanation:

Since viruses carry out no metabolism themselves, they rely solely on the living cells of the host (organism they infect) to replicate and spread from cell to cell.

Thus, viruses do not kill the cells they infect since they need them, and use them to replicate more offsprings

You might be interested in
In angiosperms, what is the name of the outer epidermal layer that protects the plant body?
Mamont248 [21]

Answer:

cuticle

Explanation:

6 0
3 years ago
Read 2 more answers
Which one of the following statements MOST accurately describes methylation? Methyl groups are most often added to cytosines adj
Kisachek [45]

The most true answer from these choices is:

Methyl groups most often added to guanine-cytosine base pairs because they are held by three hydrogen bonds, and this decreases the probability of gene expression.

3 0
3 years ago
What is true for carbohydrates?
Nitella [24]

Answer:

the 3rd one

Explanation:

4 0
3 years ago
Read 2 more answers
What are the characteristics of greenhouse
mart [117]

Answer:

Access. A basic feature of any greenhouse is access. ...

Vents. One of the first greenhouse features necessary is a means of controlling the climate – most importantly, venting excess heat. ...

Fans. Fans inside a greenhouse are necessary for two basic functions. ...

Rollup Sides. ...

Heaters. ...

Shelves and Benches. ...

Water. ...

Electricity.

Explanation:

theres more but these are the important ones .

5 0
3 years ago
The ________ is/are a portion of the broad ligament that anchors the uterine tubes. the ________ is/are a portion of the broad l
Solnce55 [7]
The Mesosalpinx is a portion of the broad ligament that anchors the uterine tubes. The broad ligament covers the uterus anteriorly and posteriorly, fuses along its lateral margins and extends the lateral walls and floor of the pelvic cavity. Mesometrium is the portion of the broad ligament which anchors the uterus.
6 0
3 years ago
Read 2 more answers
Other questions:
  • ______ is plant response to contact with a solid object.
    6·1 answer
  • Which sequence correctly describes the flow of genetic information in a cell? A. Proteins → RNA → DNA B. DNA → RNA → Proteins C.
    14·2 answers
  • ¿Es beneficioso el trabajo con células madres?
    15·1 answer
  • Please help !!!!!!!!!!
    5·2 answers
  • The carrying capacity of an ecosystem describes the maximum number of organisms that can be supported by the water, food, shelte
    14·2 answers
  • A rolling ball travels 7.3m in 3.7s. What was the velocity of the ball?
    6·1 answer
  • The image describes four finch species that live in an isolated ecosystem
    14·1 answer
  • Please help me with this question!
    6·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • DNA to RNA *<br> O transcription<br> O mutation<br> O translation<br> O replication
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!