1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex787 [66]
3 years ago
8

Explain the advantage of an increase in the number of mitochondria in slow twitch fibres. Include at least 2 points in your resp

onse
Biology
1 answer:
Georgia [21]3 years ago
5 0

Answer:

To produce more ATP molecules.

Explanation:

The advantage of an increase in the number of mitochondria in slow twitch fibers is to provide more ATP is provided to the muscles. These large number of mitochondria is responsible for the production of large amount of ATP which is a fuel that is used by the muscles of the boy in order to continue working. There is high burden on the slow twitch fibres in order to continue its movement, more mitochondria is needed.

You might be interested in
What is the primary cause for the change in seasons? A. the tilt of Earth's axis B. the distance of Earth from the Sun C. the po
Marat540 [252]

The seasons are caused by the tilt of the Earth's rotational axis. The answer is A

8 0
3 years ago
Read 2 more answers
A few months ago, there was a wildire in a forest. Only a few plants and animals survived the fire Currently, many trees that ex
Ne4ueva [31]

After the forest fire,the burnt wood will be fertilized by microbes which consider as decomposer in the food chain.It doesn't olny decompose dead animals but also organic and inorganic resources.

7 0
3 years ago
All of the following are possible EXCEPT
IrinaK [193]

Answer:

All of the following are possible EXCEPT

a voluntary decrease in the rate of breathing.

Explanation:

A voluntary does not decrease in the rate of breathing

4 0
3 years ago
As a member of the Geology Rocks Club, you like to take a rock hammer and break open rocks. These rocks will break along their _
Vikentia [17]

the answer is c because that is the answer im sure and by the way your welcome


8 0
3 years ago
Read 2 more answers
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Other questions:
  • How could the duplication of the Hox gene complex help facilitate animal adaptive radiation?
    7·1 answer
  • What is a hypothesis?
    13·1 answer
  • True or false? Selective legalization is an approach that would legalize those drugs of abuse that are the most likely to cause
    11·1 answer
  • How did Stanley Miller experiment in 1953 influence scientific thinking about the Irgun of life
    12·1 answer
  • Name at least 4 other scientists who influenced darwin’s theory.
    15·2 answers
  • Which class of organic compounds stores energy as fat?
    10·2 answers
  • The river source supports little life outside of invertebrates. For each of the organisms listed below. Give one adaption that h
    8·1 answer
  • What percentage of your genetic material is from your mother and what percentage is from your father?​
    15·1 answer
  • Approximately 3.85 billion years ago, a group of single-celled microorganisms known as __________ were alive, reproducing, and e
    15·1 answer
  • Save Cite Cited by 4 Related articles All 4 versions [PDF] physiology.org Full View Bistratified starburst amacrine cells in Sox
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!