1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa [10]
2 years ago
13

Imagine that individuals with a certain allele (B) have much greater reproductive success than those without the allele. However

, individuals with the B allele also have shorter life spans than those without the allele. How would you predict the allele frequencies in the population will change through subsequent generations
Biology
1 answer:
Sonbull [250]2 years ago
6 0
<h2>Allelic frequency </h2>

Explanation:

The B allele will become more common only if the individuals reach reproductive ages

Since the individuals with allele B have much greater reproductive success therefore once they reach the reproductive age, success to reproduce new individuals will be higher

The offsprings will carry on the allele(B allele) and pass on to the next generation

Even if the parental individuals die because of shorter life span the offsprings produced in each generation will pass on the allele to their subsequent generation  

You might be interested in
What organs are being affected from dwarfism???? And how????
Alexandra [31]

Pituitary dwarfism is caused by problems arising from the pituitary gland. The pituitary gland, also called the hypophysis, is a gland at the base of the brain that produces many different hormones. This gland is divided into the anterior (front) and posterior (back) halves. The anterior pituitary produces six hormones: growth hormone, adrenocorticotropin (corticotropin), thyroid stimulating hormone (thyrotropin), prolactin, follicle stimulating hormone, and lutenizing hormone. The posterior pituitary gland only produces two hormones: antidiuretic hormone (vasopressin) and oxytocin.

The growth process begins in the lower part of the forebrain in a small organ called the hypothalamus. The hypothalamus releases hormones that regulate the production of other hormones. When the hypothalamus releases growth hormone-releasing hormone (GHRH), the anterior pituitary is stimulated to release growth hormone (GH). Growth hormone then acts on the liver and other tissues and stimulates them to secrete insulin-like growth factor-1 (IGF-1). IGF-1 directly promotes the development of bone and muscle, causing bones to grow in length, and muscles to increase protein synthesis (make more protein).

Since growth is a complex phenomenon, it may be slowed down or stopped by abnormalities arising at any point in the process. Thus, dwarfism can result if there is a deficiency in any of these hormones, if there is a failure in the receptor cells receiving the hormonal stimuli, or if the target cells are unable to respond.

At its most basic, pituitary dwarfism results from decreased production of hormones by the anterior pituitary. When none of the hormones of the anterior pituitary are adequately produced, this is called panhypopituitarism. A common form of pituitary dwarfism is due to deficiencies in the production of growth hormone (GH). When less GH than normal is produced during childhood, an individual's arms, legs, and other structures continue to develop in normal proportions, but at a decreased rate.

<span>

hopre i helped</span>
7 0
3 years ago
Need help with some worksheets
Aleks04 [339]
What do you mean? that is not can be answered
6 0
2 years ago
Which of the following will protect against flooding
elena55 [62]
The answer is dams they protect against flooding
7 0
3 years ago
Do you think osmosis occurs when a cell is in an isotonic solution explain your reasoning
Bumek [7]
The word isotonic is used to refer to the solutions (two solutions) which have the same osmotic pressure in both sides of the semipermiable membrane. The condition allows the free movement of water across the membrane. However, this does not change the concentration of the solution across the membrane. 

Hence, osmosis may not occur in this condition. 
3 0
3 years ago
Which component is missing from the process of photosynthesis?
iren2701 [21]

Answer:

glucose is missing in the following equation

4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • By what process does nitrogen enter the living components of ecosystems?
    7·1 answer
  • What was the first county to successfully launch a satellite and place it in an earth orbit?
    7·1 answer
  • A family brings their elderly father to emergency department. He has been exposed to pneumococcal pneumonia at his retirement ho
    10·1 answer
  • Why do you think Owen is unsure about puttung the raptors on the field?​
    12·2 answers
  • The __________ regulates the flow of contents from the stomach to the duodenum.
    5·1 answer
  • Y-linked diseases _____.
    7·2 answers
  • Select the correct statement about factors that influence blood pressure. A) An increase in cardiac output corresponds to a decr
    15·1 answer
  • Cells release energy through a process called cellular respiration. When carbohydrates are used to produce energy, what reactant
    12·1 answer
  • I need help with both of these questions
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!