1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Inessa [10]
3 years ago
13

Imagine that individuals with a certain allele (B) have much greater reproductive success than those without the allele. However

, individuals with the B allele also have shorter life spans than those without the allele. How would you predict the allele frequencies in the population will change through subsequent generations
Biology
1 answer:
Sonbull [250]3 years ago
6 0
<h2>Allelic frequency </h2>

Explanation:

The B allele will become more common only if the individuals reach reproductive ages

Since the individuals with allele B have much greater reproductive success therefore once they reach the reproductive age, success to reproduce new individuals will be higher

The offsprings will carry on the allele(B allele) and pass on to the next generation

Even if the parental individuals die because of shorter life span the offsprings produced in each generation will pass on the allele to their subsequent generation  

You might be interested in
The requirement for date marking ready-to-eat tcs food prepared on-site was established to primarily address the growth of which
Nady [450]
The requirement was established principally to address the growth of LISTERIA MONOCYTOGENES, which is a bacteria that has the capacity to continue growing even at refrigerated temperatures. The date marking procedure was put in place in order to make sure that the affected foods are discarded before the bacteria can initiate food borne illness.
4 0
3 years ago
Read 2 more answers
3. What are two jobs of the cell membrane
Naily [24]

Answer: control what goes in and out of the cells , it allows needed nutrients

Explanation:

7 0
3 years ago
Which relationship is being shown in the graph
goblinko [34]

The correct answer is prey predator relationship.

The given graph possibly shows the prey predator relationship, in which the prey is shown in red and the predator is shown in blue. It is observed that the predator population generally remain less than the prey, in order to get food easily.

The prey predator relationship shows that if the population of the prey start increasing, then the population of the predator would also increase, as the predators have abundant of food. But when the population of the prey start decreasing, the predators start to decline due to the starvation.

4 0
4 years ago
Read 2 more answers
One difference between marshes and bogs
polet [3.4K]

Answer:

Marshes can contain fresh water, while bogs contain salt water.

Explanation:

5 0
3 years ago
When a signal needs to be sent to most cells throughout a multicellular organism, the signal most suited for this is a _________
Alika [10]
I believe the nanswer  is c

4 0
4 years ago
Other questions:
  • Which of the following best summarizes how hormone levels are controlled?
    7·1 answer
  • Which of the functional groups is not reactive but serves as a recognizable tag on the dna molecule and alter the expression of
    11·1 answer
  • Question 5
    6·1 answer
  • What are three renewable energy resources?
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • What heat transfer method gives plants the energy they need for photosynthesis to take place?
    7·2 answers
  • What is the purpose of the cell membrane?
    14·1 answer
  • If you could repeat the lab and make it better, what would you do differently and why?
    8·1 answer
  • Plant and animal cells isolate from their environment in order to process nutrients.
    12·2 answers
  • In an experiment carried out to study the energy flow through an ecosystem, scientists measured the total solar energy captured
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!