1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VARVARA [1.3K]
3 years ago
10

Which is an example of a vestigial structure a( tailbone of a human

Biology
1 answer:
Molodets [167]3 years ago
4 0

D. tail of a monkey.

You might be interested in
Data was collected concerning Galapagos bird beak size over time. There are several species finches, and they are also known as
astra-53 [7]

Finches adapt to the new conditions such as drought by changing the size, shape and depth of their beaks. Beak morphology varies according to drought conditions. Since after the drought, vegetation dries out and the hard, big, tough seeds remain, only the finches with deep beaks will survive. Finches adapt via their beaks to different foods sources and different local conditions.

4 0
3 years ago
Read 2 more answers
What is the most abundant salt in the sea?
Goshia [24]
The answer is Sodium Chloride 
7 0
3 years ago
Read 2 more answers
suppose that a species of toads is introduced into a new environment in an attempt to reduce the population of insects.
qaws [65]

Answer: If they are introduced to a new environment unlike their previous ones, which is wet, damp, moist, and humid areas, the population of toads in the area will most likely die, and the insects will become overpopulated (or rapidly grow)

Explanation: Because the food chain needs to stay stable!

3 0
3 years ago
4.Paramecium is able to move by hairlike structures called<br> ____
Rufina [12.5K]

Answer:

Cilia

Explanation:

           

3 0
3 years ago
Which type of organism is characterized by having jointed appendages, ability to molt, and three sets of fused segments? echinod
mel-nik [20]

The members of the phylum arthropoda have jointed legs. the number of jointed legs are variable, may be three pairs as in cockroaches, four pairs in prawns and even hundred pairs in centipedes. Members of this phylum have ability to shed their their exoskeleton(molting) and body is divided into three fused segments - head, thorax and abdomen.

8 0
3 years ago
Other questions:
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • How do animal-like protists differ from plant-like protists?
    13·1 answer
  • If your DNA went from:
    13·1 answer
  • Which of these is a disadvantage of multicellular organisms?
    9·2 answers
  • how do the life functions of unicellular organisms and multicellular organisms compare in meeting the needs for life
    11·1 answer
  • The pathophysiology instructor will emphasize that the cells of the proximal tubule have a fine, villous structure that increase
    9·1 answer
  • Lesson 01.04 Properties of Water
    12·1 answer
  • A sequence of a DNA template strand is shown.
    6·2 answers
  • A section of DNA is shown below:
    14·1 answer
  • Visit the link below and use the information to answer the following question.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!