1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dedylja [7]
3 years ago
5

If a portion of a DNA strand has the

Biology
1 answer:
Lubov Fominskaja [6]3 years ago
8 0

Answer: C

Explanation:

MRNA, the A-T is replaced with A-U but T-A stays the same

You might be interested in
Cars entering our field of vision from the side require the use of _______. A. peripheral vision B. central vision C. both perip
Komok [63]
I believe the correct answer among the choices listed above is option A. Cars entering our field of vision from the side require the use of peripheral vision. This is the side vision. The vision that occurs outside the very center of gaze. Hope this answers the question.
5 0
3 years ago
The leaves of deciduous plants are broad, flat and designed to facilitate
Afina-wow [57]

Answer:

Closing the stomata, or stoma, on the underside of the leaves in order to reduce water loss through the stoma during transpiration.

4 0
3 years ago
A neon light is placed in one evacuated (airless) chamber. A battery powered radio is placed in a second evacuated chamber. Both
LiRa [457]

Answer:

The observation that could be made in regards a neon light placed in one evacuated (airless) chambea r, and battery powered radio placed in a second evacuated chamber, switched on at the same time by remote control, is that they are managed as capacitors.

Explanation:

Capacitors, also known as condensers, store energy and, we can also see them in the sky, they are the clouds.

Capacitors are made of two electrical conductors, separated by an insulator, when you add electrical energy to a capacitor you are charging a capacitor, the opposite is known as discharging.

4 0
2 years ago
In the food pyramid, organism A represents a A) carnivore. B) decomposer. C) herbivore. D) producer.
algol13
If it is an animal like an eagle or one who preys on other animals it is a Carnivore, if it is an animal such as a cow or mouse it is herbivore, if it is a mushroom or other fungus it is decomposer, and if it is a plant like a tree or flower it is a producer.
5 0
3 years ago
Read 2 more answers
Which of the following procedures would be best for remediating the effects of soil salinization?
Ivahew [28]

Answer:

Addition of large amounts of water to leach out salts

Explanation: Hope it helps

4 0
3 years ago
Other questions:
  • I need help with my mental problems!
    6·2 answers
  • Which type of preparations allows drug effects to continue at the same level over a long period?
    13·1 answer
  • 1.solve for p
    13·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • The cell cycle is divided into two phases interphase and cytokinesis is this true
    11·2 answers
  • How does osmosis create turgor pressure in plants?
    10·1 answer
  • PLEASE HELP ITS AN IMPORTANT TEST
    15·1 answer
  • Any one please help me on this one please
    10·1 answer
  • Dr. Sanchez and her team have observed an unusual star in the Andromeda galaxy. Their data suggests that the star is being consu
    13·1 answer
  • Why did the removal of wolves affect the entire Yellowstone ecosystem?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!