1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
14

The relationship between a gene and a messenger rna is that ________.

Biology
1 answer:
11111nata11111 [884]3 years ago
7 0

Answer:

mRNAs are made from genes

Explanation:

Messenger RNA (mRNA) is formed with the process of transcription.  

During the process of transcription, double stranded DNA which contain genes are converted into mRNA with the help of enzyme RNA polymerase, so, mRNA are made from genes.

The single stranded mRNA which corresponds to the genetic sequence of a gene allows the ribosome to produce protein (Translation).

Hence, the relation between mRNA ns genes is that mRNA ar emade from genes.

You might be interested in
(GIVING BRAINLIEST!!)
JulijaS [17]
Air temperature- thermometer
Humidity-hygrometer
Air pressure- Barometer
Wind direction- wind vane
Wind speed- anemometer
precipitation- udometer

Hope this helps :))
7 0
3 years ago
Which characteristics are used to classify stars on the Herzberg Russell diagram? Check all that apply
Monica [59]

Answer:

More?

Explanation:

Can you list the answer choices?

7 0
4 years ago
Read 2 more answers
Standing near a campfire, you can feel heat. This is an example of
murzikaleks [220]

The correct answer is convection because the campfire warms the air around the person.  

Convection refers to the transfer of mass motion of a fluid like water or air when the heated fluid is made to be carried away from the heat source, that is, carrying energy with it. Convection takes place when particles with an ample of heat energy in a gas or liquid move and occupy the place of constituents with less heat energy.  

Heat energy is conducted from hot places to cooler places by the process of convection.  


3 0
4 years ago
"Now that you have come up with an equation that describes the relationship between amounts of different nucleotide bases in DNA
Dima020 [189]

Answer:

G - 21%

T - 29%

A - 29%

Explanation:

Nucleotide bases in DNA are complementary. Adenosine (A) binds to Thymine (T) while Cytosine (C) binds to Guanine (G). Hence the composition of A in DNA is the same as that of T; and that of C is the same as that of G.

From the information given, C is 21%

Therefore G is also 21% of the genome as  C is bound to G, the therefore are the same proportion.

C and G make up 42% of the genome (that 21% + 21%).

The remaining 58% (100%-42%) is made up of A + T

Similarly the proportion of A is equal to that of T,

Hence A is 29% (half of 58%) and T is 29%.

4 0
3 years ago
Read 2 more answers
Which level of economy would be most directly impacted by a weekly farmer's market?
kirza4 [7]
It should be A, Local
5 0
3 years ago
Other questions:
  • What is the fastest way to administer nicotine to the brain?
    5·1 answer
  • Which are causes of desertification?
    6·2 answers
  • Difference between food chain and web
    11·2 answers
  • In a certain population of wolves, a mutation takes place and several wolves
    12·1 answer
  • How are glucose and pyruvate molecule similar? How are they different?
    12·2 answers
  • A small population of white-footed mice has the same intrinsic rate of increase (r) as a large population. If everything else is
    9·1 answer
  • _______ behavior is inherited and programmed in the genetic code.
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What evidence is there to support a problem with the consumers in the BioDome?
    10·1 answer
  • Why would “The year without a summer” be considered destructive (no using gogle)
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!