1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
blondinia [14]
3 years ago
9

HELP! This is the amount of oxygen present at a specific time that can be used in aerobic cellular respiration.

Biology
2 answers:
frosja888 [35]3 years ago
8 0

Available oxygen is the wright answer


skad [1K]3 years ago
5 0

Available oxygen

Available oxygen is the amount of oxygen present at a specific time that can be used in aerobic cellular respiration.

Aerobic cellular respiration is a metabolic process that occurs within the cells of organisms. In this process, oxygen is used in the mitochondria to chemically convert organic molecules such as glucose into adenosine triphosphate (ATP), with the release of water and carbon dioxide as waste products. Aerobic cellular respiration results in a larger amount of energy (ATP) which is used by the cell to perform its activities.

You might be interested in
HELP! ANSWER IF YOU KNOW!!
Zarrin [17]

A is the correct answer

8 0
4 years ago
Which of the following is the main disadvantage of laboratory experiments? a. elimination of causal factor is increased b. the l
lisov135 [29]

Answer:

b. the laboratory setting may not be a good representation of the real-world setting

Explanation:

The laboratory setting is different from the real world settings due to the real world settings having uncontrolled variables and conditions. Whereas the laboratory setting have controlled variables and conditions in which experiments could be performed under. The controlled or uncontrolled conditions could either influence the experiments positively or negatively.

3 0
3 years ago
How does the equation for cellular respiration compared with the equation for photosynthesis?
nignag [31]
In plants, photosynthesis, occurring in chloroplasts, is an anabolic (bond-building) process whereby CO2 and H2O combine with the use of light (photon) energy. This yields O2 and sugar (i.e. glucose). This occurs in 2 phases: light-dependent and dark (Calvin cycle) reactions, which both continually recycle ADP/ATP and NADP/NADPH.
The catabolic (bond-breaking) process in plants is cellular respiration, in which glucose is broken down with O2 by glycolysis (cytoplasm only) and mitochondrial reactions (Krebs cycle and E.T.C.) to yield CO2 and H2O. These reactions recycle ADP/ATP and NAD/NADH. The CO2 and water produced by cellular respiration feed into the photosynthetic processes, and in turn, the O2 and glucose resulting from photosynthesis supply the respiratory reactions.
5 0
4 years ago
Although Arroyo does not mention the term "watershed," it was discussed in the unit as being closely related to and impacted by
rusak2 [61]

Answer:

Arroyo integrated the term “watershed“ by saying that Oxfam and Swiss Re with the Rockefeller foundation are helping farmers building hillside terraces to conserve water and they are also providing for insurance when the droughts do come.Water shed relates to drought and heat because it will suffer and there would be less water to fill surface water resources and less water to make its way through the earth and into groundwater reservoirs.

Explanation:

7 0
3 years ago
Read 2 more answers
PLZ HELP ASAP
valkas [14]
1. The cell membrane plays it’s role in division by sustaining its organelles and division of its self to separate cytokinesis
6 0
3 years ago
Other questions:
  • To see why, calculate the energy absorbed from your body if you eat 0.70 kg of -9 ∘c snow which your body warms to body temperat
    5·1 answer
  • Which compound is a metabolic intermediate of the light-independent reactions in photosynthesis?
    8·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • on the planimetric map the ___ tells you the number of inches on the map for every actual mile that the map represents
    12·2 answers
  • Why are there so many different species of honeycreeper living on the Hawaiian Islands?
    5·1 answer
  • Help i’m doing a quiz right now.
    5·1 answer
  • 6. What happens to the carbon in our bodies when we die?
    5·1 answer
  • Which term names part of the peripheral nervous system?
    5·1 answer
  • HOOOMANNNNNSS answer this, please.
    10·2 answers
  • Which portion of the nasal cavity is lined with sebaceous and sweat glands and numerous hair follicles?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!