1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BigorU [14]
3 years ago
15

Sickle cell anemia is a genetic disorder that can be diagnosed by observing a sample of blood. Which instrument would be utilize

d to view blood cells?​
Biology
1 answer:
Norma-Jean [14]3 years ago
4 0
A microscope is the best tool
You might be interested in
Discuss why prenatal care is so important.
insens350 [35]
Prenatal care as well as preconception can help prevent complications and inform women about important steps they can take to protect their infant and ensure a healthy pregnancy.
4 0
3 years ago
Read 2 more answers
On average, bone marrow accounts for about 4 percent of a person’s total body mass. If your patient weighs 200 pounds (90.7 kilo
NeTakaya

Answer:

Many people with blood cancers, such as leukemia and lymphoma, sickle cell anemia, and other life-threatening diseases, rely on bone marrow or cord blood transplants to survive.

Healthy bone marrow and blood cells are needed in order to live. When disease affects bone marrow so that it can no longer function effectively, a marrow or cord blood transplant could be the best treatment option; for some patients it is the only potential cure.

Explanation:

7 0
2 years ago
Read 2 more answers
ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
Morgarella [4.7K]
A. using new technology to provide additional supporting data.
7 0
3 years ago
20<br> Compared with mitosis, the process of meiosis results in daughter cells<br> that are-*
USPshnik [31]

Answer:

D haploid (n) with a smaller number of chromosomes than the parent cells

Explanation:

meiosis results in gametes which have half the number of chromosomes and are therefore diploid because they have one set only. that is because later, the two cells with half the chromosomes (egg and sperm) join together to make a diploid cell

8 0
3 years ago
Dark skin ( a result of increased melanin production in equatorial populations), is likely a response to ultraviolet radiation b
AlladinOne [14]

Answer: Skin cancer

Explanation:

Melanin is a pigment derived from an amino called acid tyrosine. The most common form of melanin is called eumelanin, which is a polymer of dihydroxyindole carboxylic acids and their reduced forms.<u> When a person is exposed to the ultraviolet light (UV) from the sun, the melanocytes will produce eumelanin to prevent the skin from burning and damage to the cell nuclei (where DNA is found)</u> of the epidermis. This melanin production causes the skin to darken. The eumelanin in the skin then acts as a natural sunscreen by blocking the damaging effects of sunlight. So, skin darkens when exposed UV light, thus providing greater protection when needed by producing more eumelanin, but it also becomes more likely to develop melanoma, which is a type of skin cancer. This is because UV rays damage the DNA of skin cells. <u>The DNA (deoxyribonucleic acid) is the genetic material that has the instructios to the growth and functioning</u> of an organisms). Skin cancers begin when eumelanin protection is not sufficient and this damage affects the DNA of the genes that control the growth of skin cells. <u>This results in a tumor, which is the uncontrolled growth of cells </u>(in this case, skin cells) because there will be a mutation in DNA that affects the function of the cells.

8 0
3 years ago
Other questions:
  • The lower rear portion of the pelvic bone on which one sits is called the ________.
    14·1 answer
  • The many kinds of dogs are all of the same species because
    15·2 answers
  • Which phrase describes a characteristic of a scientific law?
    7·1 answer
  • How many categories are plants separated into?a.1b.2c.3d.4
    8·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Zinc is a trace mineral that plays a critical role in
    14·1 answer
  • What is the central support structure of a plant
    8·1 answer
  • A farmer made a pesticide (a chemical that keeps insects away) from the leaves of the plant and sprayed it on his crops. The fir
    6·1 answer
  • Which of these statements best summarizes the information provided by the diagram?
    10·1 answer
  • Which of the following plants is grown from a bulb​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!