1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddik [55]
3 years ago
12

------------is a life-threatening disease, characterized by high blood pressure that may afflict women late in the second or ear

ly in the third trimester.
Biology
1 answer:
Galina-37 [17]3 years ago
6 0

Answer:

The correct answer is- Preeclampsia

Explanation:

Preeclampsia is a complication during pregnancy which is characterized by high blood pressure in the pregnant woman and damage to internal organs like liver and kidney.

This complication starts normally after 20 weeks of the pregnancy. Before starting preeclampsia the pregnant woman's blood pressure is normal. Preeclampsia can lead to serious complications if it untreated and the delivery of the baby is the most effective treatment.  

Therefore preeclampsia is a life-threatening disease, characterized by high blood pressure in pregnant women.

You might be interested in
Which of the following environmental factors likely led to the exponential growth seen in fireweed after the Yellowstone wildfir
aleksandrvk [35]

Answer:

Decrease in competition from other plants.

Explanation:

Decrease in competition from other plants is the environmental factors likely leaf to the exponential growth seen in fireweed after the Yellowstone wildfires because decrease in population from other plants will lead to a particular species dorminating a particular geographical area and this dorminating species are Dorminant when competition has been reduced by wild fire and this will lead to exponential growth where the available resources will be abundance or unlimited or resources increases.

7 0
3 years ago
Help please :)!!!
Illusion [34]

Answer:

It would be A: a cell that has double the number of chromosomes as the parent cell

and if for some reason that is wrong then it could possibly be C and just use the same explanation.

Explanation:

This is because Haploid Gametes are the things that are produced during meiosis-which is a type of cell division which reduces the number of chromosomes in a parent diploid cell by half

7 0
3 years ago
dalton propuso que el atomo posee electrones localizados en orbitas que rodean el nucleo. Cada orbita presenta una cantidad de e
Scilla [17]
Es una experiencia guiada por pensamientos críticos
4 0
3 years ago
A roller coaster car rapidly picks up speed as it rolls down a slope. As it starts down the slope, its velocity is 4 m/s. But 6
damaskus [11]

Answer:

i think the answer is -7

Explanation:

4 - 46 = -42       -42\6 is -7  i dont know if its right

5 0
3 years ago
What is a shooting star, a comet or a meteor burning in our Earth’s Atmosphere?
kolezko [41]

What do you mean by "What is a shooting star, a comet or a meteor burning in our Earth’s Atmosphere?"

edit: ohhhhh you are asking what a shooting star is...

its particles of comets or astoroids/metor enter the atmosphere at very high speeds and burn up

6 0
3 years ago
Read 2 more answers
Other questions:
  • The placebo effect can convince a person that an alternative therapy or medicine is the reason they are better even though many
    7·1 answer
  • Identify a method scientists use to share information with one another
    8·1 answer
  • Durante la expresión génica, el ADN se transcribe en ARN en el núcleo. Luego, el ARN se traduce en proteínas en el citoplasma. ¿
    14·1 answer
  • Which spot delivers the greatest amount of energy to the floor
    15·1 answer
  • Complete the sentences to describe selective breeding. Selective breeding is the process by which humans breed plants or animals
    15·2 answers
  • I would really appreciate it if someone can helpp!!!
    14·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Water covers approximately:
    5·1 answer
  • How is information from the field of embry ology used as evidence for evolution
    6·1 answer
  • 1. state the characteristics of Chrysophytes.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!