Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer: DNA
Explanation:
DNA also referred to as deoxyribonucleic acid, is the hereditary material in humans and almost all other organisms. Almost every cell in a person’s body has the same DNA. Most DNA is located in the cell nucleus.
There are dominant and recessive alleles. when one allele from each parent combine, there are a couple different possibilities for traits. for example, whenever a parent gives off a dominant allele, you will automatically have that trait because it would have combined with another dominant allele, or it would have overpowered the other recessive alelle. you cam find these different combos by using a punnet square. but also, some traits, such as eyecolor, are determined by incomplete dominance, when the colors of your parents in their greenness combine in to a new color. or, you can have codominance when you have one of each eyecolor of your parents.
Answer:
The reaction of iodine and starch turns the solution blue
