All categories

3 years ago

Describe an example of endosymbiosis that has been observed and documented.

2 answers:

5 0

I recall that Professor Kwang had observed amoebas that had cannibalized bacteria cells. The bacteria were slaughtering the amoebas, but somehow some survived. This particular group of amoebas contained bacteria that thrived inside it. Hence the name, endosymbiosis. However, this lucky group and it's offspring could not survive without bacteria.

KiRa [710]3 years ago

3 0

In 1987, Professor Kwang Jeon of the University of Tennessee observed a number of amoebas (single-celled eukaryotes) that had ingested bacteria cells. The bacteria were killing off most of the amoebas, but a small number of the amoeba survived and returned to their normal modes. However, the invading bacteria were still present within surviving amoebas. Jeon continued to experiment with the amoebas and discovered that these surviving amoebas, and their offspring, could not survive without the bacteria. Jeon's discovery and experimentation proves it is possible for a cell to become dependent on an invading organism.

You might be interested in

What do you notice about the two molecules?

anastassius [24]

Answer:

If it's in the table, it's an element! Atoms can join together - they form bonds together - to make MOLECULES. For example, two atoms of hydrogen hook together to form a molecule of hydrogen, H2 for short.

It would have been a little helpful if you added a picture but I hope this is helpful.Thank you!

Explanation:

7 0

1 year ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

How long will r136a1 live?

loris [4]

A star’s life expectancy depends on its mass. Generally, the more massive the star, the faster it burns up its fuel supply, and the shorter its life. The most massive stars can burn out and explode in a supernova after only a few million years of fusion. A star with a mass like the Sun, on the other hand, can continue fusing hydrogen for about 10 billion years. And if the star is very small, with a mass only a tenth that of the Sun, it can keep fusing hydrogen for up to a trillion years, longer than the current age of the universe.

4 0

3 years ago

What will mostly happen if the temperature of the liquid is slightly reduced?

Andreyy89

It will begin to freeze

6 0

2 years ago

In dna, which base pair goes with adenine

d1i1m1o1n [39]

Thymine
The two strands are held together by hydrogen bonds between the bases, with adenine forming a base pair with thymine, and cytosine forming a base pair with guanine.

4 0

2 years ago