1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sunny_sXe [5.5K]
3 years ago
11

What is the difference between a prokaryotic and a eukaryotic cells?

Biology
2 answers:
Ratling [72]3 years ago
7 0

You are a eukaryote. Your cells are eukaryotic. Eukaryotic cells contain membrane-bound organelles, including a nucleus. Eukaryotes can be single-celled or multi-celled, such as you, me, plants, fungi, and insects.

Bacteria are an example of prokaryotes. Prokaryotic cells do not contain a nucleus or any other membrane-bound organelle. Prokaryotes include two groups: bacteria and another group called archaea.

zheka24 [161]3 years ago
4 0
Prokaryotic cells do not have a nucleus and are single celled organisms. eukaryotic cells have a nucleus and are in multi-cellular organisms
You might be interested in
Imagine that beak color in a finch species is controlled by a single gene. You mate a finch homozygous for orange (pigmented) be
Leona [35]

Answer: Incomplete dominance

Explanation: Incomplete dominance is a type of inheritance, specifically a type of intermediate inheritance when a dominant allele, or form of a gene, does not completely mask the effects of a recessive allele, and the organism’s resulting physical appearance shows a blending of both alleles. The result is a phenotype (expression) where the expressed physical trait is a combination of both of the phenotypes that belong to the alleles. One allele doesn’t mask or dominate the other alleles in this instance. It is also called semi-dominance or partial dominance.

In short, incomplete dominance is when neither gene is fully dominant, and the result is a brand new trait.

The Punnett square shows genetic inheritance as a simple model with only two different versions of alleles: dominant and recessive. In this simple relationship, dominant alleles always override the recessive alleles to be expressed in the organism’s appearance or phenotype. It was created by Gregor Mendel and was important because it contradicted popular ideas at the time that the traits of the parents were simply permanently blended within their offspring. However, modern biologists have discovered that inheritance isn’t as simple as this model would suggest.

An example of incomlete dominance in humans would be hypercholesterolemia.

7 0
3 years ago
Facrtors that affect blood flow through the capillaries​
krok68 [10]

Answer:

volume of the blood

cardiac output

8 0
3 years ago
Read 2 more answers
NASA scientists found on Mars a molecule similar to DNA, except it only uses three bases (A, C, T). Just like DNA, however, it i
pav-90 [236]

Answer: 4 codon

Explanation:

We have two important data, that a molecule brought from Mars uses only three bases (A, C and T) and that it has 30 amino acids

Knowing that to encode 30 amino acids with 3 bases, you need to have 4 bases in your codon.

We have the possibility that having 4 bases can be encoded enough like this:

3 ^ 4 = 81.

however if we do the same procedure with 3 basic codons we will get an insufficient result

  3 ^ 3 = 27

so the most likely codon number is 4

3 0
3 years ago
This molecule or ion never uses active transport as its motive force for reabsorption into blood capillaries in the kidney.
antiseptic1488 [7]
Water is the substance that does not use the aid of an active transport in the absorption of blood capillarities inside the kidney. An active transport would only be applicable if the molecule requires being transferred from an area lower concentration to the area of higher concentration across a membrane. 
7 0
3 years ago
What is The process by which water crosses a selectively permeable membrane is called?
inessss [21]
That would be called "osmosis" :)
8 0
3 years ago
Read 2 more answers
Other questions:
  • What two groupings do the scientific names of the salamanders represent?
    10·1 answer
  • Arrange the events to describe how a volcano forms and erupts.The plates move constantly.
    5·1 answer
  • Based on the dosages a patient receives, what level of precision should a syringe have to ensure that the patient receives the p
    11·2 answers
  • What phase do sister chromatids move apart?
    12·1 answer
  • Solzhenitsyn believe that writers and artists can do________.
    9·1 answer
  • QUICKE!!!!!!!!! Which shows the correct arrangement of the layers of the earth?
    5·2 answers
  • What is another name for the large intestine? what digestive presses occurs in the large intestine?
    10·2 answers
  • I NEED HELP ASAP PLEASE if you can help me with this whole sheet !!!!!
    5·1 answer
  • Whats the Location for Postsynaptic
    12·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!