1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aleksandr-060686 [28]
3 years ago
13

Using the Pedigree above, which of the following is true about person #3

Biology
1 answer:
LenaWriter [7]3 years ago
4 0

Answer:B

Explanation:

There genotype is AA A= Normal a=has the disease

You might be interested in
What does a food chain due ?
spin [16.1K]

Answer:

Shows the flow of food and energy

4 0
3 years ago
Read 2 more answers
A nurse is caring for a pregnant client in her second trimester of pregnancy. the nurse educates the client to look for which da
snow_tiger [21]
Chronic backache

<span>The nurse should provide preventive measures for chronic backache as a consequence of lordosis when caring for this client. Chloasma is characterized by darkened areas on the face, particularly over the nose and cheeks. It is also known as the mark of pregnancy. Chloasma is not caused by lordosis. Diastasis occurs as the pregnancy progresses when the rectus muscle stretches to the point that it separates. It is not caused by lordosis. Edema in lower extremities occurs due to an impeded venous return caused by pressure of growing fetus on pelvic and femoral areas. It is not caused by lordosis.</span>
8 0
3 years ago
True or false? One possible way to alter chromatin structure such that genes could be transcribed would be to make histone prote
Dmitrij [34]

Answer:

False

Explanation:

The histones that are more positively charged, tight hardly to negatively charged DNA. So, enzymes, such as acetyltransferases, that reduce the positive charge of histones promote transcription.

Chromatin structure and its modifications can change the package of the DNA and consequently, alter the gene expression. The most common modifications of the chromatin are covalent modifications such as acetylation/deacetylation (by acetyltransferases and eacetylases), methylation (by methyltransferases), and phosphorylation (by kinases).  This is the way of gene expression regulation.

The effects of modifications are different, for example methylation promotes  condensation of the chromatin and as a consequence, prevents binding of transcription factors to the DNA (transcription is repressed).

Acetylation loosens the association between nucleosomes and DNA (because it neutralizes the positive charge of histones) and consequently promotes transcription. Deacetylation is a process opposite to acetylation.

5 0
3 years ago
Which action would most likely increase the greenhouse effect?
natta225 [31]

Answer:

D. Burn more oil for heating homes

Explanation:

Encouraging people to conserve power would help weaken the greenhouse effect, not increase it. Stopping cutting down the trees in the Amazon forest would also heavily help weaken the greenhouse and not increase it. And unlike the others, using more nuclear power plants wont affect the greenhouse atfect but instead affect our air quality. Our problem is that burning coal, oil, and gas produces carbon dioxide, which adds to the supply already in the atmosphere, increasing the greenhouse effect and thereby increasing the temperature of the Earth so therefore its D.

6 0
3 years ago
Read 2 more answers
Which are the very small particles that make up matter? atoms molecules mass weight
andre [41]

Answer:

The awnser is atoms

Explanation:

Atoms are the building blocks of everything.

5 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The woolly mammoth lived during the Ice Age. Why did it become extinct?
    10·2 answers
  • Which statement correctly compares and contrast the three stages of cellular respiration that occurs in the presence of oxygen
    7·1 answer
  • Which best describes the scientists who have contributed to our current body of knowledge? A. Almost all males B. People of all
    15·2 answers
  • DNA polymerase has multiple mechanisms for editing and error correction, whereas the capacity for error correction in RNA polyme
    13·1 answer
  • What is genotype and phenotype
    9·2 answers
  • What type of environment did the first land plants probably live in?
    12·1 answer
  • PLEASE THIS IS SUPER EASY!!!!!!<br><br><br> Question is attached!!!!
    15·2 answers
  • Is hydrogen peroxide an input or an output?
    9·1 answer
  • Somebody help me so I can give y’all some points
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!