1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
2 years ago
6

19. Photosynthesis and cellular respiration are related

Biology
2 answers:
Simora [160]2 years ago
8 0

Answer:

Photosynthesis and cellular respiration are related  processes. What do these processes have in common?

From the reaction by photosynthesis, it produces what respiration uses in its own reaction.

Photosynthesis produces glucose as a result of reaction between carbondioxide and water while respiration makes use of the glucose by breaking it down to give carbondioxide and water with ATP

Explanation:

Kobotan [32]2 years ago
4 0

Answer: Both processes interconvert energy from one form to another. Photosynthesis uses product of respiration (Carbon dioxide and water), while respiration uses the products of photosynthesis (glucose and oxygen).

Explanation: In photosynthesis, six molecules of water reacts with six molecules of carbon dioxide in the presence of light energy to yield one molecule of glucose and six molecules of oxygen while in respiration, six molecules of oxygen reacts with one molecule of glucose to produce six molecules of carbon dioxide, six molecules of water and energy in form of ATP.

Photosynthesis: 6H2O + 6CO2 + sunlight --> C6H12O6 + 6O2

Respiration: C6H12O6 + 6O2 --> 6CO2 + 6H2O + ATP (energy)

You might be interested in
If flying squirrels were brought to Australia, what would their relationship be with sugar gliders
krek1111 [17]
No.. & what is sugar gliders?
8 0
2 years ago
Here are six breeds of dogs and the various abilities based upon their preferred characteristics. Some traits were deemed more i
nikitadnepr [17]

Answer:

f and c

Explanation:

4 0
3 years ago
Read 2 more answers
Why is homeostasis important for survival
ExtremeBDS [4]
Homeostasis is maintaining an equilibrium or balance. Human bodies only function under very specific conditions, so it is important to maintain them through homeostasis. Otherwise, the proper conditions to function will be missing and we won't be able to function at all.
8 0
2 years ago
What did Rosalind Franklin contribute to the understanding of DNA molecules?
RoseWind [281]

Answer:

The correct answer is A) An image indicating the shape of a DNA molecule. See the explanation below, please

Explanation:

Rosalind Franklin through studies of X-ray diffraction and crystallography, showed the double helix structure of the DNA molecule.

5 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • What problems can an algal bloom cause in an ocean?
    8·1 answer
  • 2 Points
    13·2 answers
  • The medical specialist that frequently determines the cause of death is the
    12·1 answer
  • What would happen if there were no iron in the blood<br>​
    10·2 answers
  • Trace evidence is a type of circumstantial evidence, examples of which include:
    14·1 answer
  • Place the steps shown below in the correct order.
    7·1 answer
  • Fast helpppppp
    14·1 answer
  • Which of the following best describes the main concept behind Darwin's theory of natural selection?
    9·1 answer
  • Testicular temperature control is accomplished through the actions of the.
    14·1 answer
  • How is a plant cell built?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!