1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Talja [164]
3 years ago
13

Why would cannibalism be favored by natural selection?

Biology
1 answer:
crimeas [40]3 years ago
5 0

Answer: Because if we assume the cannibal has to fight to the death then the stronger will win and the weaker will die off.

Explanation:

You might be interested in
What is the meaning of 2^3​
Ket [755]

Answer: The meaning of 2^3 is basically, 2 to the power of three.

Explanation: 2^3= (2x2x2)

5 0
4 years ago
Read 2 more answers
Your best friend wants to spend less time playing video games and asks you to help him design a plan to change his behavior. Ple
jonny [76]

To devise a plan using  reinforcement and punishment, in order to change your friend's behavior so that he spends less time playing video games, it is necessary to change your perception of his actions.

<h3 /><h3>Positive and negative reinforcement</h3>

Reinforcement refers to the stimulus of the behavior, which can be positive when there is a stimulus that involves the repetition of the behavior in the future, due to a favorable outcome after the action.

Negative reinforcement, on the other hand, corresponds to the removal of a negative result to perform an action.

<h3 /><h3>Positive and negative punishment</h3>

Positive occurs when there is the purposeful use of an unfavorable result after a behavior considered inappropriate. Negative punishment is related to taking something you want out of a situation to decrease the behavior you want to change.

Therefore, using both theories, a plan for someone to spend less time playing video games could spend more time with their friends, as a positive reinforcement, and pre-program their device to turn off after a certain time, as a negative reinforcement.

On the other hand, a positive punishment could be having to clean your room every time you spend a lot of time using the video game, and as a negative punishment, it could be disconnecting the internet to reduce the behavior.

Find out more information about reinforcement here:

brainly.com/question/3262992

5 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
The type of tissue that covers body surfaces lines body cavities and forms glands is
BARSIC [14]
The answer is Epithelial tissue!
8 0
3 years ago
Write the definition you have of The Law of the Conservation of Energy (don’t cut and paste):
Rina8888 [55]

Answer:

The law of conservation of energy states that energy

Explanation:

It can neither be created nor destroyed or only converted from one form of energy to another. This means that a system always has the same amount of energy... unless it's added from the outside. I hope this helps.

8 0
3 years ago
Read 2 more answers
Other questions:
  • How long does it take for light from a star that is 8 light years away to reach the Earth?
    13·2 answers
  • The pigment molecules responsible for photosynthesis are located in the
    12·1 answer
  • What has to happens in order to natural selection to occur
    14·1 answer
  • Plz anwser questions 1-2 in complete sentences, just say as much as you know, will mark brainest!!
    9·1 answer
  • Please explain the difference between an isotonic solution and a solution in equilibrium. Please do not use anything from the in
    9·1 answer
  • Why do phospholipids form a bilayer in water?
    11·1 answer
  • A woman with normal blood clotting ability whose father was a hemophiliac and whose mother was normal with no family history of
    7·1 answer
  • BigMoney Inc. has also had a major spill of inorganic H_2 that contaminated the soil around their plant. Scientists at BigMoney
    13·1 answer
  • Given that the fossil record provides the key evidence for evolution, what is the importance of the theory of evolution?
    15·1 answer
  • What is the role of RNA polymerase?Which molecule brings amino acids to the ribosomes to be assembled into proteins?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!