1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nlexa [21]
3 years ago
13

The diploid generation of the plant life cycle always _____. See Concept 29.2 (Page 625) The diploid generation of the plant lif

e cycle always _____. See Concept 29.2 (Page 625) is larger and more conspicuous than the haploid stage produces eggs and sperm is called the gametophyte develops from a spore produces spores
Biology
1 answer:
marissa [1.9K]3 years ago
5 0

The diploid generation of the plant life cycle always PRODUCE SPORES. See Concept 29.2 (Page 625) The diploid generation of the plant life cycle always PRODUCE SPORES. See Concept 29.2 (Page 625) is larger and more conspicuous than the haploid stage produces eggs and sperm is called the gametophyte develops from a spore produces spores

You might be interested in
Why do you think Harvey placed the sea urchin cells in a hypersonic solution?​
Marina CMI [18]
I don’t knowjrjdjfjf
8 0
3 years ago
Neurons may be classified according to several characteristics. Which of the following is correct? A. Group A fibers are mostly
den301095 [7]

Answer:

Option (B).

Explanation:

Neurons or nerve cell are the basic structural and functional unit of the nervous system. Fibers are the thread like long projection of the nerve cells.

Neurons are classified into three fibers- Group A fibers, B fibers and C fibers. The group C fibers cannot capable of doing the saltatory conduction of the nerve impulse because they are unmyelinated.

Thus, the correct answer is option (B).

3 0
3 years ago
Why do we have storage macromolecules, such as fats, in our bodies?
Reptile [31]

Answer:

Our bodies can break down these macromolecules to provide energy for  endergonic reactions in our bodies

3 0
3 years ago
Explain how replacing asphalt with gravel or other permeable material can improve water quality.
Ira Lisetskai [31]
When coming to building something, some materials are more vulnerable to water and can wear away easier. Some can keep the water in, so depending on the material, the water quality can be better sustained.
8 0
3 years ago
Read 2 more answers
What did Mendel call the first two individuals that mate in a genetic cross?
Cloud [144]

The correct answer is C!

6 0
3 years ago
Read 2 more answers
Other questions:
  • What part of cell theory did schleiden and schwann disagree about?
    13·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Where is the cardiovascular control center in the brain?
    15·1 answer
  • Please can you guys help me
    5·1 answer
  • What’s is the substance that chromosomes are made from?
    5·2 answers
  • A fly has two alleles for the color of its eyes. the green allele is recessive, and is represented by q. the blue allele is domi
    15·2 answers
  • Picture attached
    5·1 answer
  • Compare and contrast the various types of grasslands.
    14·1 answer
  • PLEASE HELPPP!!!!!!ASAP!!!!!!!!!!! PLEASEE!!FIRST ANSWE WILL BE MARKED BRAINLIST!!!
    14·2 answers
  • What is notmhfdsdszfxcghjioklp[;]'
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!