1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nlexa [21]
3 years ago
13

The diploid generation of the plant life cycle always _____. See Concept 29.2 (Page 625) The diploid generation of the plant lif

e cycle always _____. See Concept 29.2 (Page 625) is larger and more conspicuous than the haploid stage produces eggs and sperm is called the gametophyte develops from a spore produces spores
Biology
1 answer:
marissa [1.9K]3 years ago
5 0

The diploid generation of the plant life cycle always PRODUCE SPORES. See Concept 29.2 (Page 625) The diploid generation of the plant life cycle always PRODUCE SPORES. See Concept 29.2 (Page 625) is larger and more conspicuous than the haploid stage produces eggs and sperm is called the gametophyte develops from a spore produces spores

You might be interested in
They are passed down through gametes from each parent, which are created by the process known as
beks73 [17]
Meiosis, I think. Hope that helps!
5 0
3 years ago
Read 2 more answers
Is genetic engineering a good idea? I need details in the answers :) 20 points answer. $$$$$
TEA [102]
I think that genetic engineering is a good idea because it helps cure deseases that people cant cure, and could possibly cure cancer some day. 
Hope my oppinion helped!
5 0
4 years ago
Read 2 more answers
Toxic things that add to land pollution
mamaluj [8]

World's Top 10 Toxic Pollution Problems

Lead-Acid Battery Recycling. ...

Mercury and Lead Pollution from Mining. ...

Coal Mining (Sulphur Dioxide and Mercury Pollution) ...

Artisanal Gold Mining (Mercury Pollution) ...

Lead Smelting. ...

Pesticides Pollution from Agriculture and Storage. ...

Arsenic in Ground Water. ...

Industrial Waste Water.

5 0
3 years ago
Which of the following is another term for reclining restraint? A. Lateral recumbency B. Sternal recumbency C. Sitting restraint
Effectus [21]
Lateral recumbancy: <span>A reclining restraint where the animal is laid on its side.</span>
3 0
4 years ago
Read 2 more answers
Help with this question
svp [43]

Answer:

You should mention a question if you want someone to answer it.

4 0
3 years ago
Other questions:
  • In a population of beetles, some are green, some are brown, and some are mixed. If the beetles live in vegetation, the ________
    15·2 answers
  • BEST ANSWER GET BRAINLIEST!!
    11·2 answers
  • 2. List the oceans in order form largest to smallest.<br> geos
    12·2 answers
  • With the depletion of fish stocks in coastal waters, more fishing is being conducted in deeper waters. deep-water species are be
    8·1 answer
  • A DNA segment is changed from AATTAG to AAATAG. This is called what?
    11·1 answer
  • The human genome project is dedicated to the sequencing of the human genetic code. Some people are opposed to sequencing the gen
    15·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • According to the cell theory, all cells come from __________ cells.<br> A. existing<br> B.fertile
    7·2 answers
  • DNA is located in the ____________________________of eukaryotic cells.
    5·2 answers
  • Living things can weather rocks by both mechanical and chemical means. true or false
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!